ID: 1110167558

View in Genome Browser
Species Human (GRCh38)
Location 13:72461371-72461393
Sequence CACAGATACCAGTTTAAACT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110167558_1110167559 0 Left 1110167558 13:72461371-72461393 CCTAGTTTAAACTGGTATCTGTG No data
Right 1110167559 13:72461394-72461416 TCTTGCAACAAAATTATCCCTGG No data
1110167558_1110167562 29 Left 1110167558 13:72461371-72461393 CCTAGTTTAAACTGGTATCTGTG No data
Right 1110167562 13:72461423-72461445 AAATTCATCCTACTATCTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110167558 Original CRISPR CACAGATACCAGTTTAAACT AGG (reversed) Intergenic
No off target data available for this crispr