ID: 1110170090

View in Genome Browser
Species Human (GRCh38)
Location 13:72490259-72490281
Sequence TCTGAGCCAATAATTGAAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110170087_1110170090 30 Left 1110170087 13:72490206-72490228 CCAATCAATTAAGTAATGGAGGG No data
Right 1110170090 13:72490259-72490281 TCTGAGCCAATAATTGAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110170090 Original CRISPR TCTGAGCCAATAATTGAAAA TGG Intergenic
No off target data available for this crispr