ID: 1110170964

View in Genome Browser
Species Human (GRCh38)
Location 13:72499499-72499521
Sequence GAATTCCTACCCACAGCCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110170962_1110170964 15 Left 1110170962 13:72499461-72499483 CCCTAATTGTCATGTGGCTCTAG No data
Right 1110170964 13:72499499-72499521 GAATTCCTACCCACAGCCCCTGG No data
1110170960_1110170964 21 Left 1110170960 13:72499455-72499477 CCTGCACCCTAATTGTCATGTGG No data
Right 1110170964 13:72499499-72499521 GAATTCCTACCCACAGCCCCTGG No data
1110170963_1110170964 14 Left 1110170963 13:72499462-72499484 CCTAATTGTCATGTGGCTCTAGA No data
Right 1110170964 13:72499499-72499521 GAATTCCTACCCACAGCCCCTGG No data
1110170957_1110170964 30 Left 1110170957 13:72499446-72499468 CCCTCACTCCCTGCACCCTAATT No data
Right 1110170964 13:72499499-72499521 GAATTCCTACCCACAGCCCCTGG No data
1110170958_1110170964 29 Left 1110170958 13:72499447-72499469 CCTCACTCCCTGCACCCTAATTG No data
Right 1110170964 13:72499499-72499521 GAATTCCTACCCACAGCCCCTGG No data
1110170959_1110170964 22 Left 1110170959 13:72499454-72499476 CCCTGCACCCTAATTGTCATGTG No data
Right 1110170964 13:72499499-72499521 GAATTCCTACCCACAGCCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110170964 Original CRISPR GAATTCCTACCCACAGCCCC TGG Intergenic
No off target data available for this crispr