ID: 1110171509

View in Genome Browser
Species Human (GRCh38)
Location 13:72506306-72506328
Sequence GTCTTTGAGATGTGCATGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110171509_1110171515 21 Left 1110171509 13:72506306-72506328 CCAGACATGCACATCTCAAAGAC No data
Right 1110171515 13:72506350-72506372 CTTGTATGTAGCCGCTGCAGGGG No data
1110171509_1110171512 19 Left 1110171509 13:72506306-72506328 CCAGACATGCACATCTCAAAGAC No data
Right 1110171512 13:72506348-72506370 ACCTTGTATGTAGCCGCTGCAGG No data
1110171509_1110171517 29 Left 1110171509 13:72506306-72506328 CCAGACATGCACATCTCAAAGAC No data
Right 1110171517 13:72506358-72506380 TAGCCGCTGCAGGGGGACCAAGG No data
1110171509_1110171516 22 Left 1110171509 13:72506306-72506328 CCAGACATGCACATCTCAAAGAC No data
Right 1110171516 13:72506351-72506373 TTGTATGTAGCCGCTGCAGGGGG No data
1110171509_1110171514 20 Left 1110171509 13:72506306-72506328 CCAGACATGCACATCTCAAAGAC No data
Right 1110171514 13:72506349-72506371 CCTTGTATGTAGCCGCTGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110171509 Original CRISPR GTCTTTGAGATGTGCATGTC TGG (reversed) Intergenic
No off target data available for this crispr