ID: 1110171514

View in Genome Browser
Species Human (GRCh38)
Location 13:72506349-72506371
Sequence CCTTGTATGTAGCCGCTGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110171509_1110171514 20 Left 1110171509 13:72506306-72506328 CCAGACATGCACATCTCAAAGAC No data
Right 1110171514 13:72506349-72506371 CCTTGTATGTAGCCGCTGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110171514 Original CRISPR CCTTGTATGTAGCCGCTGCA GGG Intergenic
No off target data available for this crispr