ID: 1110182556

View in Genome Browser
Species Human (GRCh38)
Location 13:72635087-72635109
Sequence AGGAGATTGTTCTTGTGACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110182556_1110182565 25 Left 1110182556 13:72635087-72635109 CCATGTCACAAGAACAATCTCCT No data
Right 1110182565 13:72635135-72635157 TAAGCCCATTTGGTTGAGGTAGG No data
1110182556_1110182563 21 Left 1110182556 13:72635087-72635109 CCATGTCACAAGAACAATCTCCT No data
Right 1110182563 13:72635131-72635153 TACCTAAGCCCATTTGGTTGAGG No data
1110182556_1110182561 15 Left 1110182556 13:72635087-72635109 CCATGTCACAAGAACAATCTCCT No data
Right 1110182561 13:72635125-72635147 TACTCCTACCTAAGCCCATTTGG No data
1110182556_1110182566 26 Left 1110182556 13:72635087-72635109 CCATGTCACAAGAACAATCTCCT No data
Right 1110182566 13:72635136-72635158 AAGCCCATTTGGTTGAGGTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110182556 Original CRISPR AGGAGATTGTTCTTGTGACA TGG (reversed) Intergenic
No off target data available for this crispr