ID: 1110182558

View in Genome Browser
Species Human (GRCh38)
Location 13:72635107-72635129
Sequence GAGTAGGTTGGTGTTCCAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110182558_1110182571 29 Left 1110182558 13:72635107-72635129 CCTTTTGGAACACCAACCTACTC No data
Right 1110182571 13:72635159-72635181 TTGACCCCAGCCCAGGAGTTGGG No data
1110182558_1110182563 1 Left 1110182558 13:72635107-72635129 CCTTTTGGAACACCAACCTACTC No data
Right 1110182563 13:72635131-72635153 TACCTAAGCCCATTTGGTTGAGG No data
1110182558_1110182566 6 Left 1110182558 13:72635107-72635129 CCTTTTGGAACACCAACCTACTC No data
Right 1110182566 13:72635136-72635158 AAGCCCATTTGGTTGAGGTAGGG No data
1110182558_1110182570 28 Left 1110182558 13:72635107-72635129 CCTTTTGGAACACCAACCTACTC No data
Right 1110182570 13:72635158-72635180 GTTGACCCCAGCCCAGGAGTTGG No data
1110182558_1110182569 22 Left 1110182558 13:72635107-72635129 CCTTTTGGAACACCAACCTACTC No data
Right 1110182569 13:72635152-72635174 GGTAGGGTTGACCCCAGCCCAGG No data
1110182558_1110182561 -5 Left 1110182558 13:72635107-72635129 CCTTTTGGAACACCAACCTACTC No data
Right 1110182561 13:72635125-72635147 TACTCCTACCTAAGCCCATTTGG No data
1110182558_1110182565 5 Left 1110182558 13:72635107-72635129 CCTTTTGGAACACCAACCTACTC No data
Right 1110182565 13:72635135-72635157 TAAGCCCATTTGGTTGAGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110182558 Original CRISPR GAGTAGGTTGGTGTTCCAAA AGG (reversed) Intergenic
No off target data available for this crispr