ID: 1110182563

View in Genome Browser
Species Human (GRCh38)
Location 13:72635131-72635153
Sequence TACCTAAGCCCATTTGGTTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110182558_1110182563 1 Left 1110182558 13:72635107-72635129 CCTTTTGGAACACCAACCTACTC No data
Right 1110182563 13:72635131-72635153 TACCTAAGCCCATTTGGTTGAGG No data
1110182556_1110182563 21 Left 1110182556 13:72635087-72635109 CCATGTCACAAGAACAATCTCCT No data
Right 1110182563 13:72635131-72635153 TACCTAAGCCCATTTGGTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110182563 Original CRISPR TACCTAAGCCCATTTGGTTG AGG Intergenic
No off target data available for this crispr