ID: 1110183430

View in Genome Browser
Species Human (GRCh38)
Location 13:72644537-72644559
Sequence CAATTGCCACAAAGATAAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110183426_1110183430 9 Left 1110183426 13:72644505-72644527 CCTTCACCAATCAAGAACTCTCC No data
Right 1110183430 13:72644537-72644559 CAATTGCCACAAAGATAAACTGG No data
1110183425_1110183430 13 Left 1110183425 13:72644501-72644523 CCTTCCTTCACCAATCAAGAACT No data
Right 1110183430 13:72644537-72644559 CAATTGCCACAAAGATAAACTGG No data
1110183424_1110183430 22 Left 1110183424 13:72644492-72644514 CCATTAAGACCTTCCTTCACCAA No data
Right 1110183430 13:72644537-72644559 CAATTGCCACAAAGATAAACTGG No data
1110183427_1110183430 3 Left 1110183427 13:72644511-72644533 CCAATCAAGAACTCTCCAAACCA No data
Right 1110183430 13:72644537-72644559 CAATTGCCACAAAGATAAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110183430 Original CRISPR CAATTGCCACAAAGATAAAC TGG Intergenic
No off target data available for this crispr