ID: 1110192528

View in Genome Browser
Species Human (GRCh38)
Location 13:72747434-72747456
Sequence CCAGACCTTGCATGTTTTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 144}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110192528 Original CRISPR CCAGACCTTGCATGTTTTGG GGG (reversed) Intronic
900178608 1:1301793-1301815 CCACACCCTGCATGTGTGGGTGG - Intronic
900612258 1:3549130-3549152 CCAGACCATGCAAGCTCTGGTGG + Intronic
903626080 1:24731106-24731128 CCACCCCTTGCATGCTCTGGGGG + Intergenic
903772031 1:25770110-25770132 CCAGGCCTGGCATGTTGAGGAGG - Intronic
904319580 1:29688189-29688211 CCAGACATTGGATGCATTGGAGG - Intergenic
904908480 1:33916110-33916132 TCAGACCTTGTATATTTTGGAGG + Intronic
906319630 1:44808185-44808207 CCCGACCTGGCTTGTTTGGGAGG - Intergenic
911506448 1:98758171-98758193 CCAAACTATGCATGATTTGGGGG - Intronic
911650610 1:100383710-100383732 ACAGAACTTGCATGTTTAGGAGG + Intronic
911949537 1:104154772-104154794 CCAGACCTTTCCTGCTCTGGAGG - Intergenic
915984702 1:160452750-160452772 CCTGTCCTTGCATTTCTTGGTGG + Intergenic
916950339 1:169773798-169773820 TCAGACCTTTTTTGTTTTGGGGG - Intronic
922857933 1:228790899-228790921 GCAGACCTTATCTGTTTTGGGGG + Intergenic
923699533 1:236286621-236286643 ACAGATTTTGCATATTTTGGTGG + Intergenic
1063410746 10:5834741-5834763 CCAGCCCTGCCATGTATTGGTGG - Intronic
1064170085 10:13023725-13023747 CAAGACCTTGGATGCTTTGGAGG - Intronic
1065046200 10:21749289-21749311 CCCGACCTTGCCTGCTCTGGAGG - Intergenic
1067547278 10:47202393-47202415 CTATACTATGCATGTTTTGGGGG - Intergenic
1071212044 10:83354527-83354549 ACAGACCTTTCATATTTTTGAGG + Intergenic
1071685081 10:87745915-87745937 CAGGACCTTCCATGCTTTGGGGG - Exonic
1075543542 10:123336545-123336567 CCAGAACTTCCATGTGTTGTGGG - Intergenic
1076230569 10:128817080-128817102 CCAGACCTTGCAGGCTTAGGGGG - Intergenic
1077350054 11:2088960-2088982 CCACACCTTCCATGTCTGGGTGG - Intergenic
1079163014 11:18012411-18012433 CCGGTTCTTGCATGTGTTGGGGG - Intronic
1083188811 11:61034917-61034939 CCAGACCTTGCCTGTGGAGGTGG + Intergenic
1083301189 11:61740347-61740369 GCAGAGCTGGCATGGTTTGGAGG - Intronic
1085152623 11:74264364-74264386 CCAGGCTTTGCATGTATTAGGGG - Intronic
1094374625 12:29776868-29776890 AAAGGCCTTGCATGTATTGGTGG - Intronic
1096643184 12:53011253-53011275 CAAGACCCTGTATGATTTGGTGG + Intronic
1098568039 12:71957153-71957175 CAACACCTTGCATGATTGGGAGG + Intronic
1098982125 12:76967681-76967703 CCAGGACTTGCATGTCTGGGTGG + Intergenic
1101509163 12:105377205-105377227 CCAGCCCTTGAGTGGTTTGGAGG + Intronic
1101966957 12:109288082-109288104 CCAGACCTGGCATGCCTCGGGGG + Exonic
1104570196 12:129918305-129918327 TTACACCTTGCAAGTTTTGGGGG - Intergenic
1107283322 13:38761677-38761699 CCAGCCCTTTCATGTCTTTGTGG - Intronic
1108270943 13:48759017-48759039 CCATCTCTTGCATCTTTTGGAGG - Intergenic
1108934084 13:55865234-55865256 CCAGAACTTCCATGTATTGTTGG + Intergenic
1110192528 13:72747434-72747456 CCAGACCTTGCATGTTTTGGGGG - Intronic
1112085057 13:96021202-96021224 CAGGACCTTGCATTTTTTGCTGG + Intronic
1112401926 13:99085812-99085834 CCTCTCCTTCCATGTTTTGGAGG - Intronic
1115546391 14:34468285-34468307 CCAGATTTTGTATGTTTTGGAGG - Intergenic
1118357722 14:65028863-65028885 CAAGACTGTGCATATTTTGGGGG - Intronic
1119035526 14:71227522-71227544 ACAGAACCTGAATGTTTTGGGGG - Intergenic
1121650266 14:95553025-95553047 CCAGACCTTGAATGTGTGGCAGG + Intergenic
1121721678 14:96113298-96113320 CTAGTCCTTGATTGTTTTGGAGG + Intergenic
1123890748 15:24776039-24776061 CCAGACCTTGCATATTTTTCTGG - Intergenic
1124695981 15:31864609-31864631 CCAGAACTTCCATGTGTTGTGGG - Intronic
1125340065 15:38666506-38666528 CCATACCTAGCATATTTTGGAGG + Intergenic
1126960501 15:53988523-53988545 CAAGCTCTTGCATCTTTTGGGGG + Intergenic
1128215353 15:65930702-65930724 CCTGACCTTGCATGTGGGGGCGG + Intronic
1129516808 15:76162096-76162118 CCAGCCCTTCCCTGGTTTGGGGG - Intronic
1129781377 15:78274184-78274206 CCTGACCCTGCAGGTGTTGGTGG + Exonic
1134237131 16:12475328-12475350 CCAGATCTTGGATATGTTGGTGG + Intronic
1137485534 16:48887496-48887518 CCACACCTAGCATCTTCTGGGGG + Intergenic
1140789193 16:78374316-78374338 CCAGACCATGCATGATTTAATGG + Intronic
1141394281 16:83691015-83691037 CCAGGCCCTGAATGTTTTGAAGG + Intronic
1141848157 16:86625372-86625394 CCAGACCTGGCGTGTTTTCCTGG - Intergenic
1146896164 17:36544033-36544055 TCTGACCTTGAAGGTTTTGGAGG - Intergenic
1146919452 17:36700611-36700633 CCATGCCTTGGATGGTTTGGGGG - Intergenic
1148532895 17:48411838-48411860 CCAGACCTTTCTTGTTTTTGAGG - Intronic
1150166759 17:62951161-62951183 ACTGAGCTTGCATGTGTTGGGGG - Intergenic
1150910367 17:69381384-69381406 ACAGACCTTGTAGGTTTGGGTGG + Intergenic
1151091540 17:71445584-71445606 CCAGGCTTTACATGGTTTGGGGG + Intergenic
1203173499 17_GL000205v2_random:174161-174183 CCAGTCTTTGCTTTTTTTGGGGG - Intergenic
1153619352 18:6962409-6962431 CCCGCCCTTTCTTGTTTTGGGGG - Intronic
1155041534 18:22069303-22069325 CCAGACCTTGGGGGTTTTAGGGG - Intergenic
1156789991 18:40959987-40960009 CTAGACTTGGCATGTTTTTGAGG + Intergenic
1156916505 18:42468771-42468793 CAAGGCCTTGGAGGTTTTGGAGG - Intergenic
1159902899 18:74064754-74064776 CCAGAGCTTGCATGTTGTGCTGG + Intergenic
1161301618 19:3545443-3545465 CCACACCTGGCATGTTGTGTTGG - Intronic
1161610635 19:5240409-5240431 CCAGAGCTGGCATCTTTTAGTGG - Intronic
1163049524 19:14671650-14671672 CCAGACCTGGCATCTTCTTGGGG - Intronic
1165321998 19:35091182-35091204 CCATCCCTGGCATGTTTTGGGGG - Intergenic
1166080092 19:40438584-40438606 TCAGTCCTTGCAGGTCTTGGTGG + Intergenic
1167764530 19:51472316-51472338 CCAGAACTCACATGTTTTGCTGG - Intergenic
925404034 2:3594488-3594510 CCGAATCTTGCATGTTTTGGGGG - Intergenic
926705196 2:15832471-15832493 ACAGAGCTCGCATCTTTTGGTGG + Intergenic
929539526 2:42809797-42809819 CCAAACCCTGCGTGTTTTGTTGG - Intergenic
930088621 2:47516220-47516242 CCAGTCCTGGAATTTTTTGGGGG - Intronic
931668797 2:64628523-64628545 TAATACCTTGCATGTTGTGGTGG - Intergenic
937683545 2:124670046-124670068 TTAGACCTTCCATGTTCTGGAGG + Intronic
938274961 2:130010820-130010842 GCACACATTGCATGTTTTGAAGG - Intergenic
938325925 2:130401537-130401559 GCACACATTGCATGTTTTGAAGG - Intergenic
938408641 2:131046321-131046343 ACAGACCTGGCACGTCTTGGTGG - Exonic
938440412 2:131326473-131326495 GCACACATTGCATGTTTTGAAGG + Intronic
945135475 2:206623052-206623074 CCAGGGCTTGCTCGTTTTGGTGG + Intergenic
946817690 2:223595813-223595835 CCAGAGCCTGGATGCTTTGGGGG - Intergenic
947816550 2:233041300-233041322 CCAGACCTTCCATGTCTGAGAGG + Intergenic
948663805 2:239522402-239522424 CCAAACCTTGCTTGTCTCGGGGG + Intergenic
1169797179 20:9475824-9475846 CCAGACCTTGCCTTTTTATGAGG - Intronic
1169888403 20:10427873-10427895 GCTGACCTTGAATGGTTTGGTGG - Intronic
1170425706 20:16233472-16233494 AGAGACCTTGGATGTTTTGAGGG + Intergenic
1171227493 20:23453414-23453436 GCTGGACTTGCATGTTTTGGAGG + Intergenic
1174301753 20:49587410-49587432 CCAGAGCTTGCAAATCTTGGTGG + Intergenic
1175922230 20:62455651-62455673 CCTGAGCTTGGATGATTTGGGGG - Intergenic
1176114666 20:63426449-63426471 CCAGAACTTGAAGGTTTGGGAGG - Intronic
1176329488 21:5535803-5535825 CCAGTCTTTGCCTTTTTTGGGGG - Intergenic
1176398269 21:6285148-6285170 CCAGTCTTTGCCTTTTTTGGGGG + Intergenic
1176438888 21:6703956-6703978 CCAGTCTTTGCCTTTTTTGGGGG - Intergenic
1176463150 21:7031025-7031047 CCAGTCTTTGCCTTTTTTGGGGG - Intergenic
1176486711 21:7412804-7412826 CCAGTCTTTGCCTTTTTTGGGGG - Intergenic
1177701075 21:24640047-24640069 GTATACCTTTCATGTTTTGGGGG + Intergenic
1181455259 22:23055920-23055942 GCAGGCCTTGTATGCTTTGGGGG + Intergenic
1182014956 22:27031956-27031978 CCAGTCCTTGCATGTTCTCATGG - Intergenic
1184984625 22:48121285-48121307 ACAGAACTTACATTTTTTGGGGG - Intergenic
950468260 3:13168566-13168588 CCAGACCTTGCAGTCTTTGTGGG - Intergenic
951731710 3:25816519-25816541 CCAGATCTTGCATATTCTTGGGG + Intergenic
952950960 3:38524873-38524895 ACAGACAATGCATGGTTTGGAGG - Exonic
953421422 3:42756425-42756447 CTAGACCTTGGCTGTGTTGGTGG - Intronic
955205490 3:56892156-56892178 CCTGGCCTTGAGTGTTTTGGAGG - Intronic
955543995 3:60007987-60008009 GCAGAGCTAGCATATTTTGGGGG + Intronic
956577089 3:70763966-70763988 CCAGACCTTGCTTGTGTGGGCGG + Intergenic
957293344 3:78306080-78306102 CCACATCTTGAATGTTTTGCTGG - Intergenic
958044544 3:88267455-88267477 CTAGCCGTTGGATGTTTTGGGGG - Intergenic
959340267 3:105120644-105120666 CCAAACCTTTCTTGTTATGGAGG - Intergenic
960510293 3:118541394-118541416 CCAGGCCTTTCATGATTTAGCGG - Intergenic
967897567 3:194410736-194410758 CAAGAAATTGCATGTTTTGAAGG - Intronic
970622598 4:17839414-17839436 CCAGTTGCTGCATGTTTTGGAGG - Intronic
972268241 4:37483453-37483475 CCAGACCTTGCCTGTGGTGTAGG - Intronic
978508237 4:109484294-109484316 TCAGACCATGCATTTTTCGGAGG + Intronic
988697936 5:33642831-33642853 CTAGAGCTTACATGTTTTGTGGG - Intronic
992092163 5:73326940-73326962 CCAGACCTTCCAAGACTTGGGGG - Intergenic
993376349 5:87153354-87153376 CCTCCCCTTGCTTGTTTTGGGGG + Intergenic
994774548 5:104026155-104026177 CCGGACCTGGCATATCTTGGAGG - Intergenic
994965263 5:106661904-106661926 TCAGAGCTTTCATATTTTGGGGG + Intergenic
997382231 5:133446135-133446157 CGAGAGCCTGCAGGTTTTGGTGG - Intronic
997663729 5:135610092-135610114 CCAGACCTGGCTTGTTTTCCTGG - Intergenic
997732179 5:136189756-136189778 CCAGTCCTTGCATTTGTTTGTGG + Intergenic
1000326398 5:160175708-160175730 CCAGACCTTGCCTGTCTTTCTGG + Intergenic
1001402274 5:171452504-171452526 CCAGCCCCTGCATGTTCAGGCGG + Intronic
1005294844 6:24415080-24415102 TGAGACCTTGGATGCTTTGGTGG + Exonic
1010457862 6:76079703-76079725 ACTCACCTTGAATGTTTTGGGGG - Intergenic
1012599738 6:101080317-101080339 CCAGAGATTCCATGTTTTGGGGG + Intergenic
1013633505 6:112007721-112007743 CTGGACCTTGCTTGTTTGGGCGG + Intergenic
1016653585 6:146491619-146491641 CTAGAATATGCATGTTTTGGGGG + Intergenic
1022820074 7:33950977-33950999 CCAGATCTTGCAGGGCTTGGTGG - Intronic
1023521004 7:41049960-41049982 CGAGTCCTTTCATGTTTTGGGGG + Intergenic
1027252565 7:76408407-76408429 CCAGTCTTTGCTTGTTGTGGGGG + Intronic
1027943533 7:84716244-84716266 CCAGAGCTTGCATTTAATGGTGG - Intergenic
1028531496 7:91843168-91843190 CTAGAGCTTGCATATATTGGTGG - Intronic
1032845074 7:135745262-135745284 GCAGCCCTTCCATTTTTTGGTGG - Intronic
1033432714 7:141303719-141303741 AAAGACATTGAATGTTTTGGGGG + Intronic
1037604163 8:20423301-20423323 CCAGACATTCCATCTTCTGGAGG + Intergenic
1039419181 8:37421301-37421323 CCACACCTTCCCTGTTTTGTGGG + Intergenic
1039621359 8:38999816-38999838 TTAGAGCTTGCATCTTTTGGGGG - Intronic
1039668509 8:39566113-39566135 CAAGCCCTTGCATTTTGTGGTGG + Intergenic
1039793011 8:40890749-40890771 CCATACGAGGCATGTTTTGGGGG - Intronic
1042180091 8:66079143-66079165 GCAAACCTTTCATGTTTTTGGGG + Intronic
1044847175 8:96393274-96393296 CCAGACCTTGCATGATGTTGTGG - Intergenic
1048117244 8:131538222-131538244 CCAGACCTTGCATGCTTTGTAGG - Intergenic
1050599730 9:7238353-7238375 CCAGACCCTGTATCTTTTGTTGG - Intergenic
1050980530 9:12007125-12007147 CCAGACCTTAGATGTTATAGTGG - Intergenic
1053425052 9:38004963-38004985 CCAGAACTTGCTGGTTTTGGTGG - Intronic
1053425521 9:38007539-38007561 CCAGATCTGGCATTCTTTGGAGG + Intronic
1054795739 9:69300117-69300139 CCAGTCCTTGGAAGTTTTGAAGG + Intergenic
1057605490 9:96495589-96495611 CCACAACTTGCATGTTTTGCTGG + Intronic
1057886912 9:98836757-98836779 CCACAGCTTATATGTTTTGGGGG + Intronic
1060088353 9:120721362-120721384 CCAGGCCTTGCAGGGTTTTGGGG + Intergenic
1203432607 Un_GL000195v1:104523-104545 CCAGTCTTTGCCTTTTTTGGGGG + Intergenic
1186759246 X:12706295-12706317 CCAGTCCTTGCAAGTTTTCGGGG - Intronic
1192543388 X:71993602-71993624 CCAGGCCTGGCATGGTATGGAGG + Intergenic
1195220326 X:102740100-102740122 CCAGACATTGCATGGTTTTTAGG + Intronic
1197839016 X:130725527-130725549 CCAGCCCATGCATGTTGAGGTGG - Intronic
1202056479 Y:20837782-20837804 CCTGTGCTTGCATGTTTTTGTGG - Intergenic