ID: 1110198617

View in Genome Browser
Species Human (GRCh38)
Location 13:72820981-72821003
Sequence CCAGAGTGTAAACATCTTAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 275
Summary {0: 1, 1: 1, 2: 0, 3: 21, 4: 252}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110198617_1110198620 5 Left 1110198617 13:72820981-72821003 CCCTTAAGATGTTTACACTCTGG 0: 1
1: 1
2: 0
3: 21
4: 252
Right 1110198620 13:72821009-72821031 TAAAGAGAAAACTAATGTGATGG 0: 1
1: 0
2: 9
3: 50
4: 538

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110198617 Original CRISPR CCAGAGTGTAAACATCTTAA GGG (reversed) Intronic
901383637 1:8892129-8892151 CCAGAGCGTAAACACCATGAAGG - Intergenic
902098649 1:13967021-13967043 CTAGACTTTAAACTTCTTAAAGG + Intergenic
904302981 1:29567868-29567890 AGAGAGTTTAAACACCTTAAAGG + Intergenic
907884960 1:58584582-58584604 CCAGAGTGTAAAGCCCTTACAGG - Intergenic
908803846 1:67909165-67909187 CCAGACAGTAAACAACTTGAGGG + Intergenic
908901185 1:68958413-68958435 CAAGAGTGAAAACTTCTTAAAGG - Intergenic
911254822 1:95621311-95621333 CCAGAGTGTAAGCCTGATAAAGG + Intergenic
911785225 1:101937929-101937951 CTAGAATGTAAACACCTCAAGGG + Intronic
912545866 1:110451082-110451104 CCTGAGTGTAAACATCTGGGAGG + Intergenic
915040546 1:152964868-152964890 CCAGAGTGCAAGCTCCTTAAGGG - Intergenic
916537010 1:165712751-165712773 CCAGCGTGGAAAGATCTTATAGG + Intergenic
917293277 1:173493247-173493269 CCAGGGTGGAAACCTCTTAAAGG + Intergenic
917645852 1:177028087-177028109 CCAGACTGTAAGCTTCTTAGGGG - Intronic
919561121 1:199120296-199120318 CCAGACTGTTAACATGTTAATGG - Intergenic
921937876 1:220811446-220811468 CCAGACTGTAAACATCCTGTAGG - Intronic
922221279 1:223610404-223610426 CCAGAATGTAAGCATTTTTAGGG - Intronic
924732219 1:246722765-246722787 CTAGAATGTAAACTTCTTGAGGG + Intergenic
1063668821 10:8083358-8083380 GGAGATTGTAAACCTCTTAAGGG - Intergenic
1064002465 10:11674911-11674933 CCAGACTCTAAACTTCTTGAGGG - Intergenic
1065225023 10:23534770-23534792 CCAGAGTGTAAACACCAAACAGG - Intergenic
1066795825 10:39119506-39119528 GCAGATTGTAAACATTTTATTGG + Intergenic
1067739626 10:48884915-48884937 TTAGGTTGTAAACATCTTAAAGG + Intronic
1067989935 10:51200543-51200565 CCAGATTGTAACCATGTTGAAGG + Intronic
1068597731 10:58921426-58921448 CCAGAGTGTAAACTCCATATGGG + Intergenic
1070262141 10:74867658-74867680 CCAGAGTCTAACCATCTGCAAGG - Intronic
1070426547 10:76293834-76293856 CCAGAGAGTAAACAGATTTAAGG - Intronic
1070613225 10:77948841-77948863 CCAGATAGTAGCCATCTTAATGG + Intergenic
1071148389 10:82602213-82602235 CCAGAGAAGAAACATATTAATGG - Intronic
1071376679 10:85012963-85012985 CCAGAGTGTAGGTATCTTAATGG + Intergenic
1072556194 10:96515515-96515537 CCAAAGAGTCAACATCTAAAAGG + Intergenic
1074412447 10:113240043-113240065 CCAGAGTGGGAACTTCTCAAGGG - Intergenic
1074444179 10:113504813-113504835 CTAGATTGTAAGCTTCTTAAGGG - Intergenic
1078287219 11:9969225-9969247 CCAAGTTGTAAACATTTTAAAGG - Intronic
1081443867 11:43110592-43110614 CAAGATTGCAAACATTTTAAGGG - Intergenic
1083796180 11:65018087-65018109 CTAGAGTGTAAGCTTCCTAAGGG + Intronic
1086275514 11:85123612-85123634 CCAGAGAGTAAACATTTTCCGGG + Intronic
1087192645 11:95271604-95271626 TTAGACTGTAAGCATCTTAAGGG + Intergenic
1087302643 11:96453965-96453987 CCAGATGGTAAGCTTCTTAATGG + Intronic
1088890781 11:114042503-114042525 CCAACGTGTAAAGGTCTTAAAGG + Intergenic
1089114546 11:116083921-116083943 CCAGATTGTGAGCATCTTGAAGG - Intergenic
1090339170 11:126000517-126000539 CTATATTGTAAACTTCTTAAAGG + Intronic
1090594503 11:128306843-128306865 TTAGAATGTAAACATCTTGAGGG - Intergenic
1090955440 11:131509482-131509504 CCAGAATGTAAACTTCCTGAAGG + Intronic
1093565534 12:20598554-20598576 CCACAGTGTAAACATTTGAGGGG - Intronic
1093889647 12:24504312-24504334 CAAGAGTGTAAAGATTTTACTGG - Intergenic
1094256238 12:28430402-28430424 CCAGAGTGTGAACTCCTTTAGGG - Intronic
1095318249 12:40793067-40793089 TCAGAGTCTAACAATCTTAAAGG + Intronic
1095436962 12:42200137-42200159 CCAGAGTGTAAACTCTGTAATGG - Intronic
1095785614 12:46106022-46106044 CCAGACCATAAACATCTTGAAGG - Intergenic
1096266205 12:50124753-50124775 CCAGAGGGTAAACATACTAATGG - Intergenic
1097266806 12:57750751-57750773 CCAGAGTGTAACAACCTAAAGGG + Exonic
1097722849 12:63042176-63042198 CAAGAGTGTAAAATTCTCAAGGG + Intergenic
1098824399 12:75275208-75275230 CTAGACTGTAAACTTCTTGAAGG - Intergenic
1098867277 12:75777453-75777475 CCAGAGAGTACACAGCATAAGGG + Intergenic
1099483023 12:83192252-83192274 CAAGAGAGTAAAAATGTTAAAGG - Intergenic
1101770924 12:107750163-107750185 CCAGACTGTAAGCTCCTTAAAGG + Intronic
1101791070 12:107928244-107928266 GCAGAGTGTAAACTCCTTGAGGG + Intergenic
1102392964 12:112564207-112564229 CCAGATTGTAAACCTCTTTGAGG + Intergenic
1105295949 13:19088099-19088121 CCAGGGTGGAAGCATCTTGAGGG - Intergenic
1106693669 13:32146758-32146780 ATAGATTGTGAACATCTTAAGGG + Intronic
1107521585 13:41187529-41187551 CCAGAGTGTCAATGTCTTCAAGG - Intergenic
1108113408 13:47101990-47102012 CCAAAGGGTATACTTCTTAAGGG + Intergenic
1108733489 13:53258580-53258602 ACAGAGTGTTTACATCTGAATGG + Intergenic
1109182530 13:59230948-59230970 CAAGATTGTAAACTTCTTGAAGG + Intergenic
1109288265 13:60438065-60438087 GCAGACTGTAAACTTCTTGAGGG + Intronic
1110198617 13:72820981-72821003 CCAGAGTGTAAACATCTTAAGGG - Intronic
1110290043 13:73794775-73794797 CCAGAGTGCAAAGATCATGAAGG + Intronic
1114194271 14:20463174-20463196 CCAGAGTGTAAGCTTTTTTAAGG - Intergenic
1115094228 14:29615683-29615705 ATAGAGTATGAACATCTTAAAGG + Intronic
1115315555 14:32021335-32021357 GCAGTATGTAAACATCTTATGGG - Intergenic
1117459308 14:55928862-55928884 ACAGAGTGGATACATCTTCACGG - Intergenic
1119634706 14:76264560-76264582 CCAGACTGTAAGCTTCTTGAGGG - Intergenic
1119903836 14:78283870-78283892 CCAGATTGTAAACACTTTAGAGG - Intronic
1121380920 14:93465416-93465438 CCAGCTTGTAAATTTCTTAAGGG - Intronic
1121893780 14:97625252-97625274 ACAGAGTGTTATCATCTGAAAGG - Intergenic
1124591903 15:31061155-31061177 CTAGAGTGTAAACATCAGATGGG - Intronic
1127854226 15:62941533-62941555 CCAGAGGGGAAGCATCTTAGGGG - Intergenic
1128133804 15:65248166-65248188 CCAGAGTGTGGCCATCTAAAGGG - Intronic
1130614882 15:85395881-85395903 CCAGATTATAAACTTCTTGAGGG + Intronic
1133941649 16:10314284-10314306 CCTGAATGTAAATATTTTAAGGG - Intergenic
1135910155 16:26553218-26553240 CCAGAGTGTAAACTCCATGAGGG - Intergenic
1136928630 16:34398134-34398156 CCAAAGTGGAAACAACTCAAAGG - Intergenic
1136975944 16:35013670-35013692 CCAAAGTGGAAACAACTCAAAGG + Intergenic
1137483164 16:48869362-48869384 CCAGAGTGTAAAGACCCTGAGGG - Intergenic
1140956237 16:79869000-79869022 CCAGACTGTAAACACCTTGAGGG + Intergenic
1140964596 16:79952809-79952831 CGAGACTGTAAATTTCTTAATGG - Intergenic
1141565458 16:84898664-84898686 CCAGACTGTAAACTTCCTGAAGG + Intronic
1143033134 17:3978993-3979015 CCAGACTGTGAACCTCTTGAGGG - Intergenic
1145088596 17:19966542-19966564 CCAGACTGCAAACATCTTGAGGG + Intronic
1148205879 17:45779613-45779635 CCAGCCTGTGAACATCTTGAGGG + Intergenic
1148291642 17:46456703-46456725 TCAGGTTGTAAACATGTTAAAGG + Intergenic
1148313832 17:46674410-46674432 TCAGGTTGTAAACATGTTAAAGG + Exonic
1149227625 17:54493374-54493396 TCAGAGTGTGAACATCTATAGGG - Intergenic
1149879308 17:60272178-60272200 CTAGACTGTAAACATCATAATGG + Intronic
1150205763 17:63405637-63405659 CCAGAATCCAAACATCTAAAAGG - Intronic
1150999933 17:70363347-70363369 CCAGACTGTAAGTATCTTTAAGG - Intergenic
1154228257 18:12528261-12528283 CTAGACTGTGAACTTCTTAAGGG - Intronic
1155216072 18:23644075-23644097 CCAAAGTGTACTCAGCTTAAAGG - Intronic
1156042718 18:32841239-32841261 CTAAAATGCAAACATCTTAAAGG - Intergenic
1157082710 18:44545302-44545324 CCAGAATGGAAACTCCTTAAGGG - Intergenic
1159466725 18:68793283-68793305 CTACAGTTTAAAAATCTTAATGG - Intronic
1164017249 19:21264318-21264340 CCAGAGTGCATATATCTTTATGG - Intronic
1164328995 19:24233268-24233290 CCAAATTGTAAAGATCTTCAAGG + Intergenic
1165209774 19:34224853-34224875 CCAAAATGTAAACATCAAAAGGG - Intronic
1167215776 19:48163594-48163616 CCAGAGTGTTAGCTTCTTGAAGG - Intronic
1168041283 19:53760997-53761019 CCAGAATATAAACCTCTAAAAGG - Intergenic
925514435 2:4664668-4664690 CCATAATCTAAAAATCTTAAGGG - Intergenic
927160357 2:20252690-20252712 ACAGAGAGGAAACAGCTTAAAGG + Intronic
927658675 2:24972969-24972991 CCTAACTTTAAACATCTTAAGGG + Intergenic
929476204 2:42251768-42251790 CAAAACTGTAACCATCTTAAAGG + Intronic
931514748 2:63043129-63043151 CCAGGTTGGAAAGATCTTAAAGG - Intronic
932689713 2:73901810-73901832 ACAAAGTGTAAATTTCTTAAAGG - Intronic
933496411 2:83055226-83055248 CCAGAGTGTGAGCACTTTAAAGG - Intergenic
933607326 2:84397082-84397104 CTAGACTGTGAACTTCTTAAAGG - Intergenic
934967768 2:98737854-98737876 CCAGACTGTAAACTCCTTGAAGG - Intergenic
939290911 2:140193753-140193775 GCAGAGTATAAAAATATTAATGG - Intergenic
939613389 2:144335917-144335939 CCAGATTGTAAGCTTCTGAAAGG - Intergenic
940081640 2:149810044-149810066 GCAGTGTGTAAAAATCTTGAGGG + Intergenic
940236684 2:151518600-151518622 CCTAAGTGTTTACATCTTAACGG - Intronic
942539770 2:177003286-177003308 TCAGGGGGTATACATCTTAAGGG + Intergenic
946490902 2:220147888-220147910 CCAGGGTGTAGACATGTGAAGGG + Intergenic
1169828157 20:9792058-9792080 CCAGACTGTAAGCACCTTGAGGG + Intronic
1172859373 20:38035208-38035230 CCAGACTGTAAGCAACTTGAAGG - Intronic
1172933879 20:38605305-38605327 CCAGCCTGTGGACATCTTAAGGG - Intronic
1173313572 20:41922661-41922683 CCAGACTGCAAACAACTTGAAGG + Intergenic
1178098684 21:29242524-29242546 CCAGAGTGTAAGCTCCCTAAAGG - Intronic
1179063165 21:37998790-37998812 TCAGAGTCTTAACATTTTAATGG + Intronic
1180649660 22:17368242-17368264 CCAGATTGTACACTACTTAAAGG + Intronic
1182093419 22:27611061-27611083 CCACAGTGTAAACAACTTTGGGG + Intergenic
949151529 3:773616-773638 CCAGTGTGACATCATCTTAATGG + Intergenic
949598228 3:5570491-5570513 AGAGAGTGTAATCATCTGAAGGG + Intergenic
950989079 3:17412404-17412426 CCAGAGGGTAAACTGCTGAAAGG + Intronic
951372752 3:21871441-21871463 CTAAAGTGTAAACTTCTTGAAGG + Intronic
951674686 3:25224520-25224542 GCAGAGAGAAAACATCTTAAAGG - Intronic
952068489 3:29602585-29602607 CCAGAAAGTAAAGATGTTAAAGG + Intronic
955645505 3:61133260-61133282 CCAGATTGTGAACCTCTTGAGGG + Intronic
956328955 3:68083988-68084010 TCAGAGAGTGAAAATCTTAATGG + Intronic
956402282 3:68893356-68893378 CCAGAATGTAAAGTTCTTGAGGG + Intronic
956694158 3:71904456-71904478 CAAGAGTGTAAACTCCCTAAGGG - Intergenic
958110510 3:89137396-89137418 CCAGAGTGTAATAAGCCTAAGGG - Intronic
959395721 3:105835557-105835579 TAAGAGTGTAAACATTTTACTGG - Intronic
961911735 3:130324359-130324381 CCAAAATGTAAACAACTTACAGG + Intergenic
963252415 3:143115476-143115498 CTAGAGTGTAAACTTCATGAAGG + Intergenic
963428435 3:145162973-145162995 CCATAGTGTAGATATCTAAATGG + Intergenic
965014816 3:163143535-163143557 CCAGAGTATAATTATCTTGAAGG - Intergenic
965167239 3:165210752-165210774 CCATACTGTAAACTCCTTAAAGG + Intergenic
966332492 3:178829973-178829995 CCACCGTGTAACCACCTTAAGGG + Intronic
966698153 3:182814504-182814526 TCAGATTGTAAAATTCTTAAGGG - Intronic
969409418 4:7018356-7018378 CCAAAGTGTAGCCATTTTAATGG - Intronic
969548423 4:7847830-7847852 ACAAAGTGTAGACATCTGAATGG - Intronic
971764570 4:30813482-30813504 CCAGAGTGTACATTTCTTGAGGG - Intronic
971931884 4:33095086-33095108 CCAGAGTGTGTACTTCTTTATGG + Intergenic
972176237 4:36409837-36409859 CCAGAGTGCACACATCATGACGG + Intergenic
973559102 4:52116403-52116425 CTAGACTGTAAGCACCTTAAAGG + Intergenic
973939189 4:55887439-55887461 CTAGAATGTAAACTTCATAAAGG - Intronic
974167069 4:58217097-58217119 CTAGTGTGCAAACACCTTAAGGG - Intergenic
975138098 4:70893884-70893906 CTAGAATGTAAACTTCTTAGGGG + Intergenic
975288708 4:72650992-72651014 CTAGTTTGTAAACATCTCAAGGG - Intergenic
976912073 4:90319725-90319747 CCAGTATGTAAAAATGTTAATGG + Intronic
977007692 4:91591995-91592017 CCAGACTGTATAAATATTAATGG + Intronic
978301742 4:107276729-107276751 ACAGAGAATAAATATCTTAAAGG + Intronic
980328040 4:131374180-131374202 GCAGAGTGTAAAGATCCAAAAGG + Intergenic
981199579 4:141965036-141965058 CCAGAATGTGAAAATCTTTAAGG + Intergenic
982696082 4:158602666-158602688 ATAGAGTATAAACTTCTTAAAGG + Intronic
983160805 4:164411947-164411969 CTAGACTGTAAACATATTAAGGG + Intergenic
983472297 4:168172626-168172648 CTAGAATGTAAGCATCTTAAGGG - Intronic
986451933 5:7874139-7874161 CCATAGTTTAAAAATGTTAAAGG + Intronic
986488601 5:8266171-8266193 CCAGAGAGGAAACATCCTGATGG + Intergenic
988373946 5:30408731-30408753 CGAGTGTGTAAACATCTACAGGG + Intergenic
988453508 5:31366391-31366413 CCACACTGGAAACATTTTAAGGG - Intergenic
988673544 5:33408034-33408056 CTAGACTGTAAGCCTCTTAAAGG - Intergenic
990075411 5:51840480-51840502 GCAGATTGTAAGCTTCTTAAAGG + Intergenic
990273284 5:54168941-54168963 CCTGGGTGTAAACTTCTTGATGG + Intronic
990721631 5:58702295-58702317 CCACAGTTTAAACATCATATAGG + Intronic
990943581 5:61228237-61228259 CCATAGTGCAAACTCCTTAAGGG + Intergenic
991338836 5:65582256-65582278 CCAGAGTTTTAACAACTGAAAGG + Intronic
992174453 5:74135814-74135836 CCAGAATGTAAACTCCATAAGGG - Intergenic
992718484 5:79534984-79535006 CTAGATTGTAAACTTCTCAAGGG - Intergenic
993044263 5:82849388-82849410 CTAGATTGTGAACATCTCAATGG + Intergenic
993838554 5:92846929-92846951 ACAGAGTGTAAACATCTACGTGG - Intergenic
994749998 5:103725856-103725878 CCAGAGTCTAAGCTTCTTTATGG + Intergenic
996595979 5:125203310-125203332 CTAGAATGTAAACTTCTGAAGGG + Intergenic
997030457 5:130121463-130121485 CCAGAGTATAAATCTATTAAAGG + Intronic
998500101 5:142625123-142625145 CTAGACTGTAAACTCCTTAAAGG - Intronic
998547075 5:143038529-143038551 CCACGGTGTAAACATCCTTATGG - Intronic
1000533803 5:162456208-162456230 CCAGAGAGTTAACATCTTGTGGG - Intergenic
1001247314 5:170114475-170114497 ACAGAGTGTGAACTTCCTAAGGG + Intergenic
1005720507 6:28597064-28597086 CCAGATGGTAACCTTCTTAAGGG - Intronic
1006382694 6:33709578-33709600 CCAAAGTGTAAAGATCTTTAAGG - Intronic
1008090689 6:47290909-47290931 CTAGAATGTAAACTTCATAAGGG - Intronic
1008213014 6:48748703-48748725 CCAAAGTATAATCATCTTCAGGG + Intergenic
1009268183 6:61583383-61583405 CCAAACTGTAAACATCCTAGAGG - Intergenic
1010301593 6:74266681-74266703 CCAGAGAGTAAAAATCTATAGGG + Intergenic
1010807958 6:80261166-80261188 CCAGTGTGACAACAACTTAAAGG - Intronic
1012428140 6:99136664-99136686 TCATAGTGCAAAAATCTTAAGGG + Intergenic
1013587963 6:111596259-111596281 CCAGAATATAAACTTCCTAAGGG + Intronic
1013822700 6:114174366-114174388 CCAGAGTGTAAGCAGCATAAGGG + Intronic
1013980960 6:116128666-116128688 CCACTGTGTAAACACTTTAAGGG - Intronic
1014049053 6:116930440-116930462 CTAGAATGTAAACTTCTTACAGG - Intronic
1015639676 6:135317629-135317651 CCAGCCTGTAAGCAACTTAAGGG + Intronic
1016346102 6:143116208-143116230 CCACATTCTAAACATCTTAGGGG - Intronic
1016440149 6:144075028-144075050 AAAGAGTGTAAACATATAAATGG - Intergenic
1017768578 6:157626965-157626987 CCTGAGTGTCAGCATCTTATAGG + Intronic
1018200153 6:161387115-161387137 CTAGACTGGAAACATCTTGAGGG - Intronic
1021614815 7:22491346-22491368 CCATACTGCAAACTTCTTAAAGG - Intronic
1022926909 7:35065526-35065548 CCAGAGTGTGAACATAAAAATGG - Intergenic
1023766191 7:43513265-43513287 CCAGAGTGTAAAGATCTTAAGGG - Intronic
1024839215 7:53565389-53565411 CCAGACTGTGAACTCCTTAAAGG + Intergenic
1024880219 7:54076799-54076821 CCCGATTGTAAACATCCTAAGGG - Intergenic
1026077118 7:67182220-67182242 TCAGAGTGTAAGCTTTTTAAAGG + Intronic
1026699750 7:72629883-72629905 TCAGAGTGTAAGCTTTTTAAAGG - Intronic
1026932843 7:74234151-74234173 CCAGCGTGGACACATCTGAAAGG + Intronic
1027629286 7:80582331-80582353 CCAGACAGTGAACTTCTTAAAGG - Intronic
1028093471 7:86731706-86731728 CTAGAATGTGAACATCTTGATGG + Intronic
1028326965 7:89539905-89539927 CCAGAGTGTACCCTTCTTCAGGG - Intergenic
1028375356 7:90139994-90140016 CCAGAGTGTGAACATAAAAATGG + Intergenic
1028379559 7:90183661-90183683 CCATATTGCAAACTTCTTAAAGG + Intronic
1030902973 7:115147825-115147847 ACAGACTGTAAACCTCTCAAGGG - Intergenic
1031054328 7:116977132-116977154 ACAGAGTCTAGACATTTTAATGG - Intronic
1032171752 7:129590567-129590589 CAAGAGTGTAAACTGCTTCAAGG - Intergenic
1032384517 7:131512273-131512295 CCAGAGTGTTAGCTTCTTGAGGG - Intronic
1037828749 8:22176335-22176357 CCAGAGTGTAACCAGCTTCCGGG + Intronic
1038457931 8:27690112-27690134 CCAGAGTGTTAAGATCAGAAGGG - Intergenic
1038754500 8:30328043-30328065 CCAGATTGTAAGCTTCTCAAAGG + Intergenic
1039152496 8:34522331-34522353 CCAGAATGCAAACATCTCCAAGG - Intergenic
1040966391 8:53085169-53085191 GCAGAGTCTAAACATCTCTACGG - Intergenic
1043988859 8:86727590-86727612 CCAGAGAATAAACAACTTACTGG + Intronic
1044150331 8:88769010-88769032 CTAGAGTGTAAACTACTTAAAGG + Intergenic
1045583574 8:103504229-103504251 CAAGATTGTAAACTTCTTGAGGG + Intronic
1045791854 8:105992897-105992919 TCTGAGTCTAAACAACTTAATGG + Intergenic
1045818607 8:106307605-106307627 CCAGAATGAAAGCATCCTAAGGG + Intronic
1046022044 8:108676692-108676714 CTAGAATGTAAACACCTTGAGGG + Intronic
1046116735 8:109793543-109793565 CCAAAGTTTAAACATGTTAATGG + Intergenic
1046126781 8:109920194-109920216 CCAGAGTGTAAGCTCCTTAAAGG - Intergenic
1047465469 8:125108815-125108837 CTAGACTGTAAACAACTCAAAGG - Intronic
1047886558 8:129256930-129256952 TTAGATTGTAAATATCTTAAGGG + Intergenic
1048072434 8:131036554-131036576 CAAGAATGTAAACACCATAAGGG - Intronic
1048162066 8:132030685-132030707 CTAGAGTGAAAACTTCTTTAGGG + Intronic
1048345995 8:133574914-133574936 GCAGAGTGGAAAGATCCTAATGG + Intergenic
1048570688 8:135652815-135652837 CCAGATTGTAAATATCTTTAGGG + Intronic
1048652499 8:136494660-136494682 CCAGACTGTGAAAATCTTGAAGG - Intergenic
1050084549 9:1950995-1951017 CTAGGCTGTAAACTTCTTAAGGG - Intergenic
1050951226 9:11597476-11597498 CCAGAGTCAAAAAATTTTAAAGG + Intergenic
1051109092 9:13615272-13615294 GCAGAGTGAAAACATTTTATGGG - Intergenic
1052403166 9:28026262-28026284 CTAGACTGTAAACTCCTTAAAGG + Intronic
1052881506 9:33603475-33603497 CCAGAGTGTTGACATCCTCAAGG + Intergenic
1052954800 9:34245438-34245460 CCAAAATGTAAACATGTGAAGGG + Intronic
1052958484 9:34273740-34273762 CCAAAATGTAAACATGTGAAGGG - Intronic
1055182016 9:73400637-73400659 CCAGAGAATAGACATCATAAAGG - Intergenic
1055621996 9:78135532-78135554 ACAGACTGTAAACTTCTTGAGGG + Intergenic
1055731284 9:79281643-79281665 CCAGAGTATGAACTTCTTAAGGG - Intergenic
1055732717 9:79295284-79295306 CCAGATTGTGAAAATCTTGAGGG - Intergenic
1058339317 9:103874845-103874867 CTAGATTGTAAACCACTTAAAGG + Intergenic
1058808870 9:108619788-108619810 CTAGAGTATAAACCTCTTGAAGG - Intergenic
1058824780 9:108765503-108765525 CTAGAGTGTAAACTTCACAAGGG - Intergenic
1059691906 9:116693474-116693496 CCAGAGTAGACACAGCTTAAGGG + Intronic
1059836205 9:118156635-118156657 CTAGACTGTAAACATCTTGAAGG - Intergenic
1059983601 9:119799676-119799698 CCAGAGCATAGACATCTTTAGGG + Intergenic
1059993512 9:119887634-119887656 CCAGACTGTAAACTCCTTGAGGG - Intergenic
1060043489 9:120322056-120322078 CTAGGGTGTAAACACCTTGAGGG + Intergenic
1186818497 X:13261901-13261923 CTAGAGTGTAGAAATCTTTAGGG + Intergenic
1189155859 X:38756207-38756229 TTTGAGGGTAAACATCTTAAGGG + Intergenic
1191662313 X:63664472-63664494 TCTGAGTGTAAACACCTTAGTGG + Intronic
1193123567 X:77848217-77848239 CTAGAGTGTAATCTTCTTCATGG - Intronic
1193158721 X:78203679-78203701 CCAATGAATAAACATCTTAATGG + Intergenic
1193261352 X:79410277-79410299 CCAGGCTGCAAACATCTTCAAGG + Intergenic
1194665104 X:96668569-96668591 CTAGAGTGCAAACTTCTCAAGGG - Intergenic
1194670839 X:96730699-96730721 CTAGAGTGTAACCTCCTTAAAGG + Intronic
1195952785 X:110293958-110293980 CTAGAGTATAAACTTCTTAAGGG + Intronic
1196761734 X:119206930-119206952 CCAGTGTGTATACATATTTAAGG - Intergenic
1196798612 X:119522590-119522612 CTAGAATGTAAACACCTTGAAGG - Intergenic
1198083402 X:133261085-133261107 CAAGATTGTAAGCATCTTGAGGG + Intergenic
1198801020 X:140447786-140447808 CCAGACTGTAAACTACATAAAGG + Intergenic
1199078924 X:143555028-143555050 CCAGTGTGAAAAGATCTTACAGG + Intergenic
1201908857 Y:19113009-19113031 CCAAATTGTAAAGATCTTCAAGG - Intergenic