ID: 1110198638

View in Genome Browser
Species Human (GRCh38)
Location 13:72821177-72821199
Sequence TGTTAGGAATGGTGAGAAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 482
Summary {0: 1, 1: 0, 2: 3, 3: 49, 4: 429}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110198634_1110198638 5 Left 1110198634 13:72821149-72821171 CCATTAGGGTTGGAGGGTGAAGT 0: 1
1: 0
2: 0
3: 5
4: 124
Right 1110198638 13:72821177-72821199 TGTTAGGAATGGTGAGAAATGGG 0: 1
1: 0
2: 3
3: 49
4: 429

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110198638 Original CRISPR TGTTAGGAATGGTGAGAAAT GGG Intronic
902738899 1:18420664-18420686 TGAAAAGAATGGTGAGAATTTGG - Intergenic
903910569 1:26721578-26721600 TGTTTGAAATAGGGAGAAATTGG + Intronic
904274799 1:29374128-29374150 TTTTGGGAATGGTGAGAAATAGG + Intergenic
905910599 1:41650943-41650965 TGTTTGAAATAGAGAGAAATTGG - Intronic
906392596 1:45431845-45431867 TCTAAGGAATGGTGAGAAACTGG + Intronic
907179788 1:52559484-52559506 TGTTATGAATGTGGAGAAATTGG + Intergenic
907185387 1:52605150-52605172 TGCCTGGAATGGTGAGAAACTGG - Intronic
907675522 1:56514422-56514444 GGTGAGCAGTGGTGAGAAATAGG + Intronic
908834150 1:68211706-68211728 TCTCATGAGTGGTGAGAAATGGG - Intronic
909094831 1:71273635-71273657 TGGAGGGAATGGTGAGAAAAAGG + Intergenic
909095897 1:71288820-71288842 TGTTAAGGATGAGGAGAAATAGG + Intergenic
909399953 1:75216575-75216597 TGGTAAGAATGTGGAGAAATTGG - Intronic
909728488 1:78865384-78865406 TGTTAAGAATGCAGAGCAATAGG - Intergenic
910026283 1:82658578-82658600 TGTTAGAAATGCTGGGAAAAAGG - Intergenic
910360198 1:86408489-86408511 TGCTAGGCATGGTGGGATATGGG + Intergenic
911527949 1:99008050-99008072 TAATATGAATGATGAGAAATTGG - Intergenic
912976144 1:114332012-114332034 TGTTAGGAAGGGTGAGCAAAAGG - Intergenic
915961305 1:160269182-160269204 TGTCAAGGATGGGGAGAAATTGG - Intergenic
916153768 1:161824097-161824119 TGTTAGGAAATGCGAGAAAATGG - Intronic
916711099 1:167409858-167409880 GGTTAGATAAGGTGAGAAATTGG + Intronic
916784864 1:168079255-168079277 TCTTGGGCATGGTGAGAAGTAGG + Intergenic
916887935 1:169088179-169088201 AGTTAGGAATGCAGTGAAATGGG + Intergenic
917645297 1:177023680-177023702 GGCTAGGAATGGTGAGAGTTAGG - Intronic
917653786 1:177105562-177105584 TGTTAGTTATGGTGGGAAAGAGG - Intronic
917826456 1:178826540-178826562 TGCCAGGGATGGGGAGAAATGGG + Intronic
918365247 1:183801108-183801130 TGGTGAGAATGGGGAGAAATTGG - Intronic
918975270 1:191475888-191475910 TGGTAAGAATGTGGAGAAATAGG + Intergenic
920208580 1:204311914-204311936 TAGTAGGAAGGGTAAGAAATGGG - Intronic
920443388 1:205997128-205997150 GGGTTGGCATGGTGAGAAATGGG + Intronic
921857560 1:220003112-220003134 GGTTAGAAATGTGGAGAAATTGG - Intronic
921954951 1:220972666-220972688 TGACAAGAATGTTGAGAAATTGG - Intergenic
921956401 1:220988445-220988467 TTTTTGTAATGGTGAGAGATAGG + Intergenic
922115692 1:222611519-222611541 TGTCAAGAATGTGGAGAAATGGG - Intergenic
923080646 1:230650867-230650889 TTTTATATATGGTGAGAAATAGG + Intronic
923310524 1:232730355-232730377 TGGTAGAAATGGAGAGAAGTAGG - Intergenic
924155185 1:241168173-241168195 TGCAAGGAATGATGAGAAAGAGG + Intronic
924207421 1:241727727-241727749 TGATAAGTATGGTAAGAAATAGG + Intronic
924435945 1:244042374-244042396 TGTAAAGAATGGTGAGAAGATGG - Intergenic
924565690 1:245196320-245196342 TATTAGGAATGGGAAGAAAATGG - Intronic
1063458698 10:6202466-6202488 TGTTAGGAATGCAGAGTATTGGG + Intronic
1064705022 10:18062647-18062669 TGTCAAGAATGTTGAGAAATTGG - Intergenic
1065818409 10:29502744-29502766 TCTTAGGGATGGTCAGATATTGG + Intronic
1065966278 10:30773174-30773196 TGTGAGGAATGGTGGGAATCCGG - Intergenic
1068359522 10:55958216-55958238 TGTGAAGAATATTGAGAAATGGG - Intergenic
1068647933 10:59490135-59490157 TTTTATACATGGTGAGAAATGGG + Intergenic
1068858492 10:61822293-61822315 TGTAAGGAATAGTGAGATAATGG + Intergenic
1068944444 10:62715104-62715126 TTTTTGTAATGGTGAGAGATAGG - Intergenic
1069587120 10:69614604-69614626 TCATAGGAAGGGAGAGAAATAGG - Intergenic
1070374355 10:75814788-75814810 TGTTAGAAATGATGGGAAGTGGG + Intronic
1070429685 10:76324783-76324805 TATTAGTGATGGAGAGAAATTGG + Intronic
1071092695 10:81937404-81937426 TGGTAAGAATGTGGAGAAATTGG - Intronic
1071126174 10:82337616-82337638 TGGCAGGAATGTGGAGAAATAGG - Intronic
1071319545 10:84439932-84439954 GGTAGGGAATGGTGGGAAATAGG + Intronic
1071327511 10:84531483-84531505 TGTCAAGAATGTGGAGAAATGGG - Intergenic
1072135731 10:92543930-92543952 TGTTAGGAAATGTAAGATATAGG + Intronic
1072294892 10:93999522-93999544 TGTTGGAATTGGTGAGAAAGAGG + Intronic
1073750109 10:106515682-106515704 AGTAAGCAATAGTGAGAAATAGG - Intergenic
1073905007 10:108268422-108268444 TTTTGTGTATGGTGAGAAATAGG + Intergenic
1074052873 10:109895764-109895786 TATTAGAAATGGAGAGAAGTGGG - Intronic
1074786581 10:116847532-116847554 TTTCAGGAATAATGAGAAATAGG - Intergenic
1075138151 10:119805752-119805774 TGTTAGGAACAGTGAGAAAGAGG - Intronic
1077936233 11:6789759-6789781 TGGTAGGTATGGGGAGAAAATGG + Intergenic
1078198716 11:9159798-9159820 TGTTAAGGATGTGGAGAAATGGG - Intronic
1078491802 11:11776344-11776366 TGTTTGGTATGGTGGCAAATAGG + Intergenic
1079100823 11:17540951-17540973 AGTGGAGAATGGTGAGAAATGGG - Intronic
1079170441 11:18089425-18089447 TGTTAGAATGGGTCAGAAATGGG - Exonic
1079214744 11:18498568-18498590 TGTTAGGAAGATTGAGAATTCGG + Intronic
1079564340 11:21863445-21863467 AAATAGGAATGGTGAGAGATGGG + Intergenic
1080543166 11:33288907-33288929 TGTTAGAAATGGTTAGAACATGG + Intronic
1080892611 11:36422423-36422445 TGTTGGGAAAGGTGAAAGATGGG + Intronic
1081374018 11:42338338-42338360 TGTGAGGAAAGGTGACAAGTTGG - Intergenic
1082685657 11:56236035-56236057 TGATAAGAATGTGGAGAAATTGG + Intergenic
1082697836 11:56391931-56391953 TGTAAGGAAGAGAGAGAAATAGG + Intergenic
1084997417 11:72994987-72995009 TGTTGGAAGTGGGGAGAAATGGG - Intronic
1085957754 11:81421030-81421052 GGGTAGGAAGGGTGAGAAAAGGG - Intergenic
1086725022 11:90171547-90171569 TGTCAGGAATGATAAGAATTTGG + Intronic
1086859195 11:91905070-91905092 TGTTCAGAGTGGTGAAAAATTGG - Intergenic
1088217647 11:107530581-107530603 TGTTAGGAAGAGAGAGAGATGGG - Intronic
1088424684 11:109690305-109690327 TGGTTGGAATGTGGAGAAATCGG + Intergenic
1089288740 11:117424729-117424751 TGTTAGGATTGGTGAGAGCTGGG + Intergenic
1089646338 11:119882282-119882304 TTTTGTGAATGGTGGGAAATAGG + Intergenic
1090106670 11:123860536-123860558 TGTTAAGCAAGGTTAGAAATAGG - Intergenic
1090155419 11:124432548-124432570 TTATAGGACTGATGAGAAATTGG - Intergenic
1091021229 11:132101971-132101993 CTGTAGGAATGGTGGGAAATGGG - Intronic
1091257294 11:134200585-134200607 TGGTAGGAATGCAGAGAAATAGG + Intronic
1092694830 12:11159620-11159642 TCTTAGGAATGCTGGGAAACGGG - Intronic
1092989657 12:13883379-13883401 TGGTAGGAATGGTAAGAATGTGG - Intronic
1093119498 12:15251446-15251468 TTTTAGGTATGGTAAGAGATAGG - Intronic
1093557667 12:20496089-20496111 TGTGAGAAATGGTGAGAAATGGG + Intronic
1094571836 12:31647874-31647896 TGATAAGAATGTGGAGAAATTGG + Intronic
1095260845 12:40097734-40097756 TGGTGGGAATATTGAGAAATTGG + Intronic
1095536611 12:43256300-43256322 TGTTAAGGAAGGTGATAAATTGG + Intergenic
1100047709 12:90403770-90403792 TGTTAAGAAAGCGGAGAAATCGG + Intergenic
1100594874 12:96063092-96063114 TGGTAGGAAGTGTGAGAATTAGG - Intergenic
1100765423 12:97859666-97859688 TTTTATATATGGTGAGAAATAGG - Intergenic
1101014529 12:100485963-100485985 TGTTTCCAATGGTAAGAAATTGG - Intronic
1101223434 12:102664191-102664213 TGATAGGAATTGGGAGAACTCGG - Intergenic
1101404973 12:104420425-104420447 TGTTTGGAATGGAGAGGTATGGG + Intergenic
1102136226 12:110578446-110578468 TGTTGGGTGTGGTGAGACATAGG - Intronic
1103234033 12:119357375-119357397 TGTTGGGAATGGAGAGAGGTTGG - Intronic
1103343041 12:120231193-120231215 TACTAGGAATGGGGACAAATCGG - Intronic
1104956271 12:132467442-132467464 TGTTGGGGATGTAGAGAAATTGG + Intergenic
1105888037 13:24659383-24659405 TGTTAGGATTGGAGACAAGTGGG + Intergenic
1106097579 13:26661738-26661760 TGGTAAGAATGTGGAGAAATTGG - Intronic
1106461423 13:29973649-29973671 TCTAAGGAATGGTTAGAACTTGG - Intergenic
1106765734 13:32911902-32911924 TTTTTGTAATGGTGAAAAATTGG - Intergenic
1107187437 13:37540577-37540599 TATTACAAATGGAGAGAAATTGG + Intergenic
1108183235 13:47863007-47863029 TGTTATGTATAGTGAGAGATGGG - Intergenic
1109033180 13:57219962-57219984 TGTAAGGAATGCGGAGAAATAGG - Intergenic
1109548587 13:63861184-63861206 TGTTAGAAATGGTGCCTAATGGG + Intergenic
1110198638 13:72821177-72821199 TGTTAGGAATGGTGAGAAATGGG + Intronic
1110204137 13:72891566-72891588 TGTTAAGAATGTGGAGAAATTGG + Intronic
1110884688 13:80618307-80618329 TGTTAGAAATGGGGACTAATGGG + Intergenic
1111247737 13:85562946-85562968 AGTTGGGGATGGAGAGAAATGGG + Intergenic
1111311725 13:86496549-86496571 TTTTATGTATGGTGAGAGATAGG + Intergenic
1111919269 13:94393652-94393674 AGGGAGGAATGGGGAGAAATGGG - Intronic
1111920568 13:94406090-94406112 TGTTATGAATAGAGAGGAATGGG + Exonic
1112651821 13:101407952-101407974 ATTGAGGCATGGTGAGAAATAGG - Intronic
1112723250 13:102271460-102271482 AGTTTGGTATGTTGAGAAATGGG - Intronic
1113109243 13:106804564-106804586 TGTTAGTAATAGGGAAAAATGGG - Intergenic
1113895612 13:113762447-113762469 TGATAGGAATGCTGATAAAAGGG + Intronic
1114834716 14:26190193-26190215 CGTTAGGAAAGGAGAGAATTAGG - Intergenic
1115352986 14:32416178-32416200 TGATAAGAATGTGGAGAAATTGG - Intronic
1115871645 14:37810693-37810715 TGGCAGGAATGCTGAGAAACAGG - Intronic
1116010231 14:39343024-39343046 TGTTAGTAATGGTGAGATATTGG - Intronic
1117077549 14:52119332-52119354 TGTTAGCTATGTTGTGAAATGGG + Intergenic
1117226674 14:53668204-53668226 TGTTGGAAATGGTGGGAGATTGG + Intergenic
1117505949 14:56403110-56403132 TGGTAAGAATGTGGAGAAATTGG - Intergenic
1119760899 14:77151219-77151241 TGCTAATAATAGTGAGAAATTGG - Intronic
1119783733 14:77297043-77297065 TGGTGGGAATGGTGGGAACTCGG + Intronic
1120498644 14:85266689-85266711 ACTTAGGTATGGTGAGGAATTGG - Intergenic
1120665628 14:87303289-87303311 GGTTGGGAAAGGTGGGAAATAGG + Intergenic
1121153612 14:91662139-91662161 GGATAGGAATGGGGAGAAACAGG - Intronic
1122472452 14:101979713-101979735 TTTTAGGGATGGTGATAAAATGG + Exonic
1202844847 14_GL000009v2_random:159472-159494 TGTTAACAATGGGGAGAAATTGG + Intergenic
1202914248 14_GL000194v1_random:149714-149736 TGTTAACAATGGGGAGAAATTGG + Intergenic
1202878422 14_KI270722v1_random:32982-33004 TGATAACAATGGGGAGAAATTGG - Intergenic
1123797007 15:23782324-23782346 TGTTAGTAATGGGGAAAACTGGG - Intergenic
1125100052 15:35902115-35902137 TGGTAGAAATGGAGATAAATGGG + Intergenic
1126487951 15:49203696-49203718 TTTTATAAATGGTGAGATATTGG + Intronic
1127161730 15:56194772-56194794 TGGTAAGGATGGGGAGAAATTGG + Intronic
1129551845 15:76459841-76459863 TTTTTGTAATGGTGAGAGATAGG + Intronic
1129586221 15:76869085-76869107 TTTTTGGTATGGTGAGAGATAGG - Intronic
1130900691 15:88205053-88205075 TCTCAGGAGTGCTGAGAAATTGG + Intronic
1131803603 15:96098788-96098810 TGTGAGGAATAGGGAGACATGGG - Intergenic
1132946499 16:2534438-2534460 TGGTAGGAATGCAGAGAAAGGGG - Intergenic
1132969211 16:2677195-2677217 TGGTAGGAATGCAGAGAAAGGGG + Intergenic
1133656938 16:7874218-7874240 TGGCAGGAATGCAGAGAAATTGG - Intergenic
1135827327 16:25740677-25740699 TGTTGGGATTGGTGAGACAAAGG - Intronic
1137277739 16:46947877-46947899 TGTCAATAATGGTGAGAAGTTGG - Intergenic
1137913866 16:52407003-52407025 TGCTAGGCATGGTGAAAAAGGGG - Intergenic
1138247958 16:55480787-55480809 TGTTTGGAAGGGTGAGAGTTGGG - Intronic
1138704184 16:58897213-58897235 TGTTAAGGATGTAGAGAAATTGG - Intergenic
1140542651 16:75772258-75772280 TGTAAGTAATGGTGAAAAAAAGG + Intergenic
1141530008 16:84639754-84639776 TGCAGGGAATGGTGGGAAATGGG - Intergenic
1141536487 16:84684640-84684662 TGATATGAATGGTGAGAGACAGG - Intergenic
1141612363 16:85189059-85189081 TTCAAGGAATGGTGAGGAATAGG - Intergenic
1144144883 17:12387877-12387899 TGTAAGGAATGGTGAGCCATTGG + Intergenic
1146933062 17:36791686-36791708 TGTCTGGAATGATCAGAAATCGG + Intergenic
1147019752 17:37521752-37521774 GGTGGGGAATGGAGAGAAATGGG + Intronic
1149266158 17:54930258-54930280 TGATAAGAATGCTGAGTAATTGG - Intronic
1149675351 17:58455297-58455319 TTTTATATATGGTGAGAAATTGG - Intronic
1149917620 17:60625762-60625784 TGTTAGCAATGCAGAGACATGGG + Intronic
1150848235 17:68680602-68680624 TGGAAGGAAAGGGGAGAAATTGG + Intergenic
1150937858 17:69657006-69657028 TATTAGGAATAGAGAGAAATAGG - Intergenic
1151212551 17:72555346-72555368 TCTTGGGTATGGTGAGAACTAGG - Intergenic
1153120027 18:1711435-1711457 TGGTAAGAATGTGGAGAAATTGG + Intergenic
1153367507 18:4273745-4273767 TTTTACATATGGTGAGAAATGGG + Intronic
1155260940 18:24041646-24041668 TTTTAATAATGGAGAGAAATTGG + Intronic
1155823698 18:30411566-30411588 TTTTATGTATGGTGAGAGATAGG + Intergenic
1155878362 18:31114144-31114166 TGATGGAAATGGTGAGAATTGGG - Intergenic
1156809375 18:41228040-41228062 AGTTAGGAATGGTGAGATTGTGG - Intergenic
1157754105 18:50203130-50203152 TCTGAGGAATGGTGAGGACTGGG + Intergenic
1158582258 18:58694051-58694073 TGGTAGGAAAGGTGGAAAATGGG - Intronic
1158923056 18:62215624-62215646 TGTTAGGAATGCTGCAAAATAGG + Intronic
1159415182 18:68137797-68137819 TGGTACGAATGTGGAGAAATGGG - Intergenic
1159681590 18:71359954-71359976 GGTTAGTGATGGTGAGAGATGGG + Intergenic
1160260703 18:77291533-77291555 TGTTCGGAATGTGGAGATATTGG + Intergenic
1163712773 19:18856766-18856788 TGTCAGGGAGGGTGAGAAACAGG + Intronic
1164024726 19:21341299-21341321 TGATAGGAATTGGGAGAACTCGG - Intergenic
1164546558 19:29169875-29169897 TATCAGGAATAGTCAGAAATTGG + Intergenic
1164849946 19:31473245-31473267 TGTTTCTAATGGTGAAAAATTGG - Intergenic
1165651228 19:37492205-37492227 TTTTATGTATGGTGAGAGATAGG + Intergenic
1166239895 19:41483141-41483163 TTGTAGAAATAGTGAGAAATAGG - Intergenic
1167005127 19:46771197-46771219 TGTTAGAACAGGTGAGAAGTAGG + Intronic
1167880085 19:52450339-52450361 TTTTGTGTATGGTGAGAAATAGG + Intronic
1202654043 1_KI270708v1_random:2029-2051 TGATAACAATGGGGAGAAATTGG - Intergenic
925290671 2:2746444-2746466 TGTTGGTAATGGAGAGAGATGGG - Intergenic
925937595 2:8780791-8780813 TGCTAAGAAAGGTGAGAAAATGG + Intronic
926956250 2:18304052-18304074 AGCTAGGAATGGTGATTAATAGG + Intronic
927060803 2:19417369-19417391 TGTGAGGAATGGGGAAAAAAAGG + Intergenic
928607354 2:32954895-32954917 TGTTAGGAGAGATGAGGAATTGG + Intronic
928679378 2:33683894-33683916 TTTGATGAATGATGAGAAATGGG + Intergenic
929002787 2:37364557-37364579 GGTGAGGAATGGTGGGAAACAGG + Intronic
929679660 2:43979445-43979467 TGTTTGTAATAGTAAGAAATTGG - Intronic
929738475 2:44576704-44576726 TGTTAGGATTAGTGAGAGAAAGG + Intronic
930313421 2:49770459-49770481 AGTTAGAAATGGGGAGAAAAAGG - Intergenic
930324929 2:49903638-49903660 AGTGAGGAATGATAAGAAATTGG - Intergenic
930539361 2:52685779-52685801 TTTTTGTATTGGTGAGAAATAGG - Intergenic
930922985 2:56779872-56779894 AGTGAGGGATGGTGAGAGATTGG + Intergenic
932048932 2:68380058-68380080 GGTTAGGCAAGGTGAGAAAGAGG + Intronic
934541960 2:95182985-95183007 TGTTCTGAATGGAGAGAATTTGG - Intronic
935047916 2:99498480-99498502 TCTTAGGTATGGAGGGAAATGGG - Intergenic
935782681 2:106521762-106521784 TGATGGGAATGATCAGAAATGGG + Intergenic
936674607 2:114700441-114700463 TGTCAGGAATTGAAAGAAATCGG + Intronic
937070176 2:119057238-119057260 AGTTGGGAATGGTGAGGAAGTGG - Intergenic
938130605 2:128712698-128712720 TGTTAGTGATGTGGAGAAATTGG - Intergenic
939475021 2:142675741-142675763 TGTTAGCAATGGCGGGAATTGGG - Intergenic
939636285 2:144586304-144586326 TGAAAGGAATGGGGAGAACTTGG - Intergenic
939647378 2:144717246-144717268 TGTTAGAAATGATGAGATAGTGG + Intergenic
939752045 2:146060084-146060106 TGTTATATATGGTGAGAGATTGG - Intergenic
939903426 2:147879541-147879563 AGTTAGGGATGGGGAGAAAGTGG + Intronic
940701599 2:157051115-157051137 AGTGAGGAACGGTGAGAAAATGG + Intergenic
940944798 2:159603536-159603558 TGTAAGAAATGGGAAGAAATGGG - Intronic
941160602 2:162030360-162030382 TGTTAGGAATTAGCAGAAATGGG - Intronic
941297450 2:163757907-163757929 TGTTATGAGTGGTCAGAAAGAGG + Intergenic
941948502 2:171127715-171127737 AGTTTGAATTGGTGAGAAATTGG - Intronic
941995592 2:171599223-171599245 TGGTAAGAATGTGGAGAAATTGG - Intergenic
942486582 2:176446106-176446128 TGGTTGGAATGGTGATGAATAGG + Intergenic
942578247 2:177389171-177389193 TTTTGGGAATGGTAAGAAAAAGG - Intronic
942864244 2:180653040-180653062 TGTAAGGAATGTAGAGGAATGGG - Intergenic
942956341 2:181778461-181778483 AGTTAGAGAAGGTGAGAAATGGG + Intergenic
943291587 2:186078964-186078986 TGGTAAGAATGGTGAGAATCTGG - Intergenic
943662608 2:190575189-190575211 TGTTGGGGATGGTGGGAAACTGG - Intergenic
945800629 2:214425402-214425424 AGTCAGGAATGCAGAGAAATAGG - Intronic
946540939 2:220684019-220684041 TTTGAGGAATGGTGAGGAGTCGG + Intergenic
947216865 2:227757840-227757862 TGTTAACAAGAGTGAGAAATGGG - Intergenic
1169239583 20:3964816-3964838 TGTATAGAATGGGGAGAAATTGG - Intronic
1169622060 20:7518311-7518333 GGTTGGAAAGGGTGAGAAATGGG + Intergenic
1169934326 20:10866546-10866568 AGTAATGAATGGTAAGAAATAGG - Intergenic
1170216576 20:13897991-13898013 TGGTGAGAATGGGGAGAAATAGG + Intronic
1170449536 20:16467877-16467899 TGCTAGGAAAGGAGAGAAAATGG + Intronic
1170851365 20:20007514-20007536 TTGTAGAAGTGGTGAGAAATCGG - Intergenic
1172141468 20:32725076-32725098 TGTTTGTAAGGGTGAGATATGGG + Intronic
1172328526 20:34056979-34057001 TGTTTATAATAGTGAGAAATTGG + Intronic
1172544779 20:35751605-35751627 TGGTAAGAATGTGGAGAAATTGG + Intergenic
1173709182 20:45139621-45139643 TATCAGTAATGGTGAGAAATGGG + Intergenic
1174282060 20:49446727-49446749 TATGAGGAATGTTAAGAAATGGG + Intronic
1174840105 20:53893283-53893305 AGTTAGGAAAGATGAAAAATTGG + Intergenic
1176633603 21:9164389-9164411 TGTTAACAATGGGGAGAAATTGG + Intergenic
1176639729 21:9290425-9290447 TGTTAACAATGGGGAGAAATTGG - Intergenic
1177800499 21:25824164-25824186 GGTTAGGAAAGGTTAGAAACTGG - Intergenic
1178079082 21:29044350-29044372 TGGTGTGAATGGTGAGAAAGGGG - Intronic
1178877408 21:36423415-36423437 TGTGTGGGATGGTGAGAAAGGGG + Intergenic
1180348740 22:11779805-11779827 TGTTAACAATGGGGAGAAATTGG - Intergenic
1180373026 22:12063260-12063282 TGTTAACAATGGGGAGAAATTGG - Intergenic
1180389459 22:12212396-12212418 TGTTAACAATCGGGAGAAATTGG + Intergenic
1180416483 22:12722079-12722101 TGTTAACAATGGGGAGAAATTGG - Intergenic
1180423775 22:12897893-12897915 TGTTAACAATGGGGAGAAATTGG - Intergenic
1181657041 22:24310935-24310957 TGTTTGATATGGTGTGAAATAGG + Intronic
1184349714 22:43935739-43935761 GGTCAGGAGTGGTGAAAAATGGG + Intronic
1185007662 22:48291927-48291949 TGATAGGAATGGAGGTAAATTGG - Intergenic
949326635 3:2873355-2873377 TGTCAGCATTGATGAGAAATCGG - Intronic
950295105 3:11823011-11823033 TGTTGAGAATGTGGAGAAATTGG - Intronic
951688363 3:25369948-25369970 AGTTTGGAATAGTGATAAATTGG + Intronic
952798466 3:37264992-37265014 TGTTACTACTGGGGAGAAATGGG - Intronic
952914057 3:38218247-38218269 TGGTGGGAATGTGGAGAAATTGG - Intronic
953833063 3:46318892-46318914 TGGTAAGAATGTGGAGAAATTGG - Intergenic
954428565 3:50456862-50456884 TGTTATGAAGGGTGTGAAACTGG - Intronic
954908509 3:54083688-54083710 TCTTAGAAATGGAGAGAAATAGG + Intergenic
954918451 3:54168610-54168632 TGGCAGGAATGCTGAGAAGTCGG - Intronic
955030990 3:55217943-55217965 TTTTTGTAATGGTGAGAAATAGG + Intergenic
955120515 3:56053357-56053379 TGTGAGGGATGGGGAGAAGTGGG + Intronic
955152541 3:56382380-56382402 TATAAAGAATGGAGAGAAATAGG - Intronic
955311231 3:57888804-57888826 TTTTAGGAATGGAGTGAAGTAGG + Intronic
955869919 3:63426701-63426723 AGTCAAGACTGGTGAGAAATTGG - Intronic
957100475 3:75820385-75820407 TGTTAACAATGGGGAGAAATTGG + Intergenic
957184749 3:76927414-76927436 TCTTTGGAATAGTGAAAAATTGG - Intronic
958021880 3:88007290-88007312 TATTAGGCCTGGTGAGAAGTGGG + Intergenic
960694169 3:120379732-120379754 TCCTAGTAATGGGGAGAAATAGG + Intergenic
961107034 3:124250867-124250889 TGTGAGGGAGGGTGGGAAATAGG + Intronic
961596703 3:128023360-128023382 TGTTAGAAATGGAAAGAAATAGG - Intergenic
961769320 3:129237101-129237123 TCTTAGAAATGGTTAGAAATGGG - Intergenic
962259321 3:133893126-133893148 TGGTAGGAATGCTGAGTAGTTGG - Intronic
962611163 3:137077465-137077487 TGGAGGGAATGGAGAGAAATGGG - Intergenic
962876121 3:139537438-139537460 TGTTTGGAATGATGGGAAAGAGG - Intronic
963636252 3:147800711-147800733 TGTTGAGAATGTAGAGAAATAGG - Intergenic
963830362 3:150001093-150001115 TTTTGTGTATGGTGAGAAATAGG - Intronic
965330598 3:167370003-167370025 TGTAAGCCATGATGAGAAATTGG + Intronic
965946271 3:174245652-174245674 TATTAGTAATGTTGAGAATTGGG - Intronic
966292358 3:178374734-178374756 TGTGTGGAATAGAGAGAAATTGG + Intergenic
968325678 3:197812999-197813021 TGTTAAGAATGTGGAGAAATTGG - Intronic
1202747165 3_GL000221v1_random:114603-114625 TGTTAACAATGGGGAGAAATTGG + Intergenic
970413986 4:15838472-15838494 TGTGAACAATGGTGAGCAATGGG - Intronic
970785576 4:19792536-19792558 TGTTAGGTCTGCGGAGAAATGGG + Intergenic
971677436 4:29651432-29651454 TGTTAAGAATGATGAAAAAATGG + Intergenic
972091074 4:35284539-35284561 TTTTATAAATGGTGAGAAATAGG + Intergenic
972145482 4:36019741-36019763 AGGTAGGAGTGGTGAGAAATAGG + Intronic
972182600 4:36487597-36487619 TGTTAGAACTGGGGAAAAATAGG + Intergenic
972389641 4:38602582-38602604 TGTTTGGAAGGATGATAAATAGG + Intergenic
972669927 4:41205389-41205411 TTTTGGGAATGGTGAGAAAATGG - Intronic
973318273 4:48783480-48783502 TGTTAAGAATAGTGAGAAAATGG + Intergenic
973548198 4:52003448-52003470 TGTTTGTAATGGTGAAAAATTGG + Intronic
973716563 4:53682708-53682730 TGGTAAAAATGGTGAGAAGTGGG - Intronic
973801532 4:54483280-54483302 GGGTAGGAGTGATGAGAAATGGG - Intergenic
974629791 4:64472153-64472175 TGGTAGTAATGATGAGAAATAGG + Intergenic
974910756 4:68116812-68116834 TTTTATGAAAGGTGTGAAATAGG - Intronic
975383966 4:73733514-73733536 TTTGAGGAATGCTGAGAGATTGG + Intergenic
975817752 4:78236717-78236739 CATGAGGAAAGGTGAGAAATAGG + Intronic
976480557 4:85539200-85539222 TGTTAGGAATGAAGATAAAATGG + Intronic
976966432 4:91047102-91047124 TGCAAGGAATGCTGGGAAATGGG + Intronic
977795570 4:101160829-101160851 TTTTAGGAATGTAGAGAAAATGG + Intronic
977856564 4:101902069-101902091 AGATAGGAATGGTGTAAAATTGG - Intronic
978313882 4:107414875-107414897 TCTTAGGTATGGAGGGAAATGGG - Intergenic
979437245 4:120708008-120708030 TGGCAAGAATGGGGAGAAATTGG + Intronic
979921998 4:126509336-126509358 TTTTATATATGGTGAGAAATGGG - Intergenic
980032899 4:127851166-127851188 TTTTATATATGGTGAGAAATAGG - Intergenic
980421067 4:132562281-132562303 TATTTGGAATCATGAGAAATAGG + Intergenic
980854396 4:138422284-138422306 TTTTAGGATTGTTGCGAAATTGG + Intergenic
981688226 4:147479235-147479257 TGGCAAGAATGTTGAGAAATTGG - Intergenic
982808658 4:159798911-159798933 TATTAAAAATGGAGAGAAATAGG - Intergenic
982845075 4:160242142-160242164 TTTTGTGTATGGTGAGAAATAGG + Intergenic
983394677 4:167178507-167178529 TGTTAGGAAGGAGGTGAAATTGG - Intronic
984276201 4:177612988-177613010 TGTGAGGAAATGTTAGAAATAGG + Intergenic
985371947 4:189294637-189294659 TGACAGGAATGTAGAGAAATTGG + Intergenic
1202754617 4_GL000008v2_random:48819-48841 TGTTAACAATGGGGAGAAATTGG - Intergenic
986737292 5:10677456-10677478 TGACAGGAATGCAGAGAAATTGG - Intergenic
987101929 5:14598550-14598572 TGTTTGTAAAAGTGAGAAATGGG + Intronic
987575527 5:19723581-19723603 TGTTTAGAATGCTGAGAAACTGG + Intronic
988342514 5:29991921-29991943 TGATAGGAATTGTGTTAAATTGG - Intergenic
988413621 5:30917632-30917654 TGTTAGGAATGGGGAAGAAATGG + Intergenic
988527280 5:31998274-31998296 TGTTTGGAATGGTGGGAGAAGGG - Intronic
989322546 5:40153417-40153439 AGGAAGGAATGGGGAGAAATTGG + Intergenic
990033719 5:51293452-51293474 TTTTAGGAATGGAGAGAAGAAGG - Intergenic
992219443 5:74557359-74557381 TGTTAGGGATGGGGAGAGAGGGG + Intergenic
992589775 5:78282299-78282321 TTTTAGGAAAAATGAGAAATAGG + Intronic
992934911 5:81692827-81692849 TTTTATATATGGTGAGAAATAGG - Intronic
993342808 5:86745586-86745608 TGATAAGAGTAGTGAGAAATAGG - Intergenic
993630675 5:90282393-90282415 TGTTAGTAATGGAGATAAAAGGG - Intergenic
993776749 5:92009528-92009550 TGGCAGGAATGCAGAGAAATTGG + Intergenic
994977157 5:106823649-106823671 TTTCATGAATGGTGTGAAATAGG + Intergenic
995894299 5:116994624-116994646 TGTGGGGAGTGGTGAGAAACAGG - Intergenic
995913133 5:117212039-117212061 TGATAGGGATGGGGAGAATTGGG - Intergenic
996241172 5:121204248-121204270 TATTAGGAATGGTGTGGCATTGG + Intergenic
997368135 5:133338873-133338895 TGGTAGGAGTGGTGGGAAACTGG - Intronic
997457725 5:134029749-134029771 GGTTAGGGATGGTGGGAAAAGGG + Intergenic
997881266 5:137592721-137592743 GGTTAGGTGAGGTGAGAAATTGG + Intronic
998609495 5:143672541-143672563 GGAGAGGAATGGTGAGAAAAAGG - Intergenic
999027080 5:148245538-148245560 TTTTATGTATGGTGAGAGATAGG + Intergenic
999512603 5:152268321-152268343 AGTTAGAAATGGTGAGAACTAGG + Intergenic
999742238 5:154565105-154565127 AGTGAGGAGTGGAGAGAAATGGG + Intergenic
999742330 5:154565760-154565782 AGTGAGGAATGGAGAAAAATGGG + Intergenic
1000171292 5:158705461-158705483 TGTTAGGAAAGGTGACAGAGAGG + Intronic
1000545588 5:162597160-162597182 TGCAAGGAATAGTTAGAAATAGG + Intergenic
1000620888 5:163485313-163485335 TGGTAAGAATGTGGAGAAATTGG - Intronic
1000855930 5:166398097-166398119 TGGTAGAAATGGTCAGAAACTGG + Intergenic
1001866981 5:175114292-175114314 TGATAGGCATAGTGAGAGATGGG + Intergenic
1005774375 6:29114742-29114764 GGTTAGCAGTGGAGAGAAATAGG - Intergenic
1005977339 6:30809869-30809891 AGTGAGGCACGGTGAGAAATTGG - Intergenic
1006061130 6:31420189-31420211 TGTAGGAAATGGTGAGACATTGG + Intergenic
1006081251 6:31568336-31568358 TGTTAGGAGTGGTGGTAAACTGG + Intergenic
1006168730 6:32081112-32081134 TGTTTGGAATGGGGGAAAATAGG + Intronic
1006206935 6:32354424-32354446 TGTTACTAATGCAGAGAAATTGG + Intronic
1010056512 6:71571449-71571471 TGGTAAGAATGTGGAGAAATTGG - Intergenic
1010215444 6:73397188-73397210 TGGTAAGAATGTGGAGAAATTGG - Intronic
1011132321 6:84064325-84064347 GGGGAGCAATGGTGAGAAATGGG - Intronic
1011499372 6:87970890-87970912 TGTTAGGAATGTTGTAAATTTGG + Intergenic
1012128602 6:95462406-95462428 TGTTTGTAATTGTGAAAAATAGG - Intergenic
1012307450 6:97675877-97675899 TCGTAGGAAAGGTGAGATATAGG + Intergenic
1012824538 6:104130342-104130364 TGTTAATAATGGAGAGACATGGG - Intergenic
1013831808 6:114281564-114281586 TGTTAGGGATAGTGAGGAAGTGG + Intronic
1013838776 6:114364634-114364656 TATAATGAATGGTGACAAATAGG + Intergenic
1013893483 6:115054924-115054946 AGTTAGAGATAGTGAGAAATTGG + Intergenic
1014209106 6:118689458-118689480 TGTTAGGAATGAGAAGAGATGGG + Intronic
1015534628 6:134255272-134255294 TGTTGGAAATGGTGAAAAAATGG - Intronic
1015974122 6:138772332-138772354 TGTTTGTAATGGTGAAAAATGGG + Intronic
1016438703 6:144063209-144063231 TGTGTGGAAAGGGGAGAAATTGG - Intronic
1016734661 6:147463862-147463884 TGGCAGGAATGTGGAGAAATTGG - Intergenic
1017577497 6:155821429-155821451 TGTCAGGAATCGTGAGTAATTGG - Intergenic
1017999088 6:159562807-159562829 GGCTAGGAATTGGGAGAAATGGG + Intergenic
1019029787 6:169000318-169000340 TCCTAGGAAAGGTGAGACATCGG - Intergenic
1019875260 7:3804882-3804904 TGGAAGGATTGGTGAGATATTGG + Intronic
1020714055 7:11647762-11647784 TGTTAGGAAGTGTGTGATATTGG + Intronic
1020876141 7:13696868-13696890 TGGTGGGAATGGAGAGAAACAGG - Intergenic
1021380306 7:19958229-19958251 AATTAGTAATGCTGAGAAATGGG + Intergenic
1022422926 7:30241052-30241074 TATTAGGAATGGAGAGAGGTGGG + Intergenic
1022522139 7:31015257-31015279 TGGTAGGAATAGTGAGAAGAAGG - Intergenic
1022522703 7:31018234-31018256 CGTTAGGGATGGGGAGCAATGGG + Intergenic
1024302998 7:47902291-47902313 TGTTTGGAGTGGTGAGAGTTTGG - Intronic
1026223896 7:68424090-68424112 TGATAGGAATGCTGAGGAACAGG - Intergenic
1026806280 7:73431122-73431144 TGGTGGCAATGGTGAGAAAATGG - Intergenic
1027858555 7:83545175-83545197 TGCTAGGAATGTTTAGAAACGGG + Intronic
1027858623 7:83545945-83545967 TGCTAGGAATGTTTAGAAATGGG + Intronic
1028345920 7:89782233-89782255 TGTAACTAATGGTGAGACATTGG - Intergenic
1028758799 7:94470198-94470220 TGTTAGGCAAGATAAGAAATTGG + Intergenic
1029349554 7:100003632-100003654 TGTTAGAAAAGGGGAGAACTGGG - Intergenic
1029406236 7:100375434-100375456 TGGTAGGGATGGTGAGGGATGGG + Intronic
1029631000 7:101750052-101750074 TGTTTATAATGGTGAAAAATGGG + Intergenic
1030378082 7:108776900-108776922 TGTTGGCAAAGATGAGAAATTGG - Intergenic
1031051186 7:116947430-116947452 TGTTAGGAATGGGGAAACAAAGG + Intergenic
1031102488 7:117499650-117499672 TGTTAGAAATAGTCAGAACTAGG + Intronic
1031150117 7:118044467-118044489 TATTGGTAATGGAGAGAAATAGG + Intergenic
1031892021 7:127305736-127305758 TATTAGGAATGATTAGAAAATGG - Intergenic
1032063175 7:128742408-128742430 TGTTAACAATTGGGAGAAATGGG - Intronic
1032064012 7:128750916-128750938 TATTAAGAATGTTGACAAATAGG + Intronic
1032093599 7:128924975-128924997 TGTCAAGAATGTGGAGAAATTGG - Intergenic
1032636578 7:133715489-133715511 TTTTTGGAAGGGGGAGAAATTGG + Intronic
1034285363 7:149880234-149880256 TGCTAGGGATGGTGAAGAATGGG + Exonic
1034762031 7:153681575-153681597 TATTAGGAAAAGTGAGAAATGGG - Intergenic
1035747122 8:1970268-1970290 TGTCAGGGATGATGAGCAATGGG + Intergenic
1038435546 8:27533176-27533198 TGTCAGGCATTGTAAGAAATGGG + Intronic
1038439343 8:27560569-27560591 TGTTGGGAATAGAAAGAAATAGG + Intergenic
1040051499 8:43019459-43019481 TGTTAGGAATTGTTAAAAAATGG - Exonic
1040633321 8:49241153-49241175 TGCTAAGGATGGGGAGAAATTGG - Intergenic
1040663801 8:49606189-49606211 TGTTGAGTATGATGAGAAATTGG + Intergenic
1040721288 8:50327791-50327813 TGTTAAGAATGGAGAGTAAATGG - Intronic
1042181660 8:66094072-66094094 TATTAGGGATTGTGATAAATGGG - Intronic
1042289882 8:67159207-67159229 TGTTAGAAAAGGGGAGAAAGAGG + Intronic
1042292383 8:67182620-67182642 TGTTAAGGATGTAGAGAAATCGG - Intronic
1043334927 8:79163671-79163693 AGTTAGGAATGAGGAGAAAAGGG - Intergenic
1043881597 8:85549635-85549657 GGGTAGGCATGGTGAGAAGTGGG + Intergenic
1044337807 8:91008260-91008282 ATTTAGGAATAGAGAGAAATAGG + Intronic
1044562311 8:93625104-93625126 TGTTCAGAATGGGGGGAAATTGG - Intergenic
1045517030 8:102868751-102868773 TTTTAGAAAAGGTGAGAAAGTGG + Intronic
1046275984 8:111960615-111960637 TGTTAAGAATTTGGAGAAATTGG - Intergenic
1046382083 8:113464712-113464734 TGGCAGGAATGCAGAGAAATAGG + Intergenic
1047059120 8:121203267-121203289 TGTGAAGAATGCTCAGAAATGGG + Intergenic
1047261885 8:123270314-123270336 AGTTAGAAATCTTGAGAAATAGG + Intronic
1047362832 8:124184678-124184700 TTTTAATAATGGTGGGAAATGGG + Intergenic
1047563163 8:126011052-126011074 TGATAGGAATTGGGAGAACTCGG + Intergenic
1048292685 8:133192560-133192582 AAGTAGGAATGGTTAGAAATTGG - Intronic
1048474703 8:134732807-134732829 TGTGAGGAGTGGAGAGGAATGGG + Intergenic
1048622401 8:136148293-136148315 TATGAGGAATGGTGACACATGGG + Intergenic
1048664219 8:136642916-136642938 TGTGGGGAAAGGAGAGAAATAGG + Intergenic
1048681527 8:136847113-136847135 CTTTAAGAATGCTGAGAAATAGG - Intergenic
1050342952 9:4659048-4659070 TGTTAGAAATGGTAAAAAGTTGG - Intronic
1050382630 9:5046020-5046042 TGTTGAGGATGTTGAGAAATTGG - Intronic
1050841989 9:10161517-10161539 TGTTATATATGGTGAGAGATAGG - Intronic
1051370942 9:16358503-16358525 TGGTAGGGATGGTGGGAAGTGGG + Intergenic
1051794956 9:20856761-20856783 TTTTATGTATGGTGAGAGATAGG + Intronic
1051998138 9:23244442-23244464 TGTAAGGTGTGGTGAGAAATGGG + Intergenic
1052292176 9:26854898-26854920 TGATAGGAATGTGGAGCAATGGG + Intronic
1052485333 9:29090700-29090722 TTTCAGGGATGGGGAGAAATGGG + Intergenic
1052832325 9:33226631-33226653 TGTTGAGAATGTGGAGAAATTGG + Intronic
1053454609 9:38224226-38224248 TGTTGAGAATGTGGAGAAATTGG + Intergenic
1055124436 9:72702865-72702887 TTTTAGCAATGGGGAGAGATAGG + Intronic
1055682348 9:78729403-78729425 TGTTGTGTATGGTGAGAGATAGG - Intergenic
1056600373 9:88042401-88042423 TCTTAGGTGTGGAGAGAAATGGG + Intergenic
1057599117 9:96441807-96441829 TGTTGAGAATGGTGAAAAATGGG + Intergenic
1057822969 9:98347743-98347765 TTTTGTGTATGGTGAGAAATAGG + Intronic
1058304165 9:103416119-103416141 TGTTAGCAAGGATGAGAAACTGG - Intergenic
1058333836 9:103800816-103800838 TGATGGGAATAGTGAGAAAATGG + Intergenic
1058338128 9:103859376-103859398 TATTAGTAATGGTCAGAGATAGG + Intergenic
1058777506 9:108299290-108299312 TGAAAGGATTGGTGAAAAATAGG - Intergenic
1058929315 9:109703117-109703139 TTTTAGAAATGGTAAAAAATAGG - Intronic
1059056631 9:110988648-110988670 GGTTAAGAATGTGGAGAAATTGG + Intronic
1059266301 9:113034605-113034627 TGAAAGGAATGGAGAGAAAGAGG - Intergenic
1061521695 9:131122070-131122092 TGTTAGGAAGGGGGAGGTATGGG + Exonic
1203756442 Un_GL000218v1:132018-132040 TGTTAACAATGGGGAGAAATTGG + Intergenic
1203715801 Un_KI270742v1:144693-144715 TGTTAACAATGGGGAGAAATTGG + Intergenic
1203535412 Un_KI270743v1:33538-33560 TGTTAACAATGGGGAGAAATTGG - Intergenic
1203650053 Un_KI270751v1:108253-108275 TGTTAACAATGGGGAGAAATTGG + Intergenic
1186180220 X:6966864-6966886 TGTTAAGGATGGTGAGGAACAGG + Intergenic
1186588857 X:10906720-10906742 TTTTATGAATGGTGAAAAATAGG + Intergenic
1188271169 X:28142494-28142516 TGGCAGCAATGGTTAGAAATTGG + Intergenic
1188376441 X:29435447-29435469 TGATAAGAATGTGGAGAAATTGG - Intronic
1188594792 X:31886207-31886229 AGTTAGGAATTGTGTGAGATAGG - Intronic
1189834311 X:45005071-45005093 TCTTAGGTATGGAGGGAAATGGG + Intronic
1190371433 X:49745897-49745919 TTTTGTGTATGGTGAGAAATTGG - Intergenic
1191015181 X:55801942-55801964 TTTAAGGAATAGTGAGCAATTGG - Intergenic
1192500415 X:71646457-71646479 TTTTGTGTATGGTGAGAAATAGG + Intergenic
1192687364 X:73321237-73321259 TGATAGGAATTGGGAGAACTCGG - Intergenic
1192712933 X:73610398-73610420 TGTTAGGAATGGTTAGTCAGTGG - Intronic
1192856789 X:75020458-75020480 TGTCAAGAATGTGGAGAAATTGG - Intergenic
1194551577 X:95307439-95307461 AGCTAGGAATGGAGAAAAATGGG + Intergenic
1194910471 X:99636612-99636634 TGTTGGCAAAGATGAGAAATTGG + Intergenic
1195652022 X:107294895-107294917 TGGTAGGAATGTAGAGAAACTGG - Intergenic
1195950842 X:110271005-110271027 TGAGAGGAATGGAGAGAAATGGG + Intronic
1196370598 X:114975390-114975412 TGTTGGGAATGGTGTAAGATAGG - Intergenic
1197056313 X:122124032-122124054 TGGTATGAATGGGGAGAAAAGGG + Intergenic
1197096491 X:122602902-122602924 TTTTTTGTATGGTGAGAAATAGG - Intergenic
1197381837 X:125753631-125753653 TTTTATGTATGGTGAGAGATAGG + Intergenic
1198489159 X:137121569-137121591 TGTTAAGAAGGGAGAGAAAGTGG + Intergenic
1198496830 X:137201742-137201764 TGCTAGCAATGGTGGGAACTTGG + Intergenic
1198748021 X:139909668-139909690 TGTTACCACTGGGGAGAAATTGG + Intronic
1198919740 X:141712139-141712161 TGTTAGACATGGTGAGAAGTGGG + Intergenic
1199337427 X:146635849-146635871 TGTTTAGAATAGAGAGAAATTGG + Intergenic
1199595046 X:149500331-149500353 TGTTGGGAAGGGTGAGGATTTGG - Intronic
1200945213 Y:8828811-8828833 TGGTAGAGATGGTGAGAAGTGGG + Intergenic
1201100748 Y:10670909-10670931 GGTTTGGAATGGAGTGAAATGGG - Intergenic
1201170029 Y:11249643-11249665 TGATAACAATGGGGAGAAATTGG + Intergenic
1201508480 Y:14731432-14731454 TGGCAAGAATGGTGAGAAAAGGG - Intronic