ID: 1110202959

View in Genome Browser
Species Human (GRCh38)
Location 13:72874857-72874879
Sequence GGGGATGTTCATAATGGGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 741
Summary {0: 1, 1: 1, 2: 62, 3: 212, 4: 465}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110202959 Original CRISPR GGGGATGTTCATAATGGGGT AGG (reversed) Intronic
900079681 1:846505-846527 GGGGATGTTGATAATGGGGGAGG + Intergenic
900534637 1:3170801-3170823 GGGGGTTTGCATCATGGGGTGGG - Intronic
901750134 1:11401495-11401517 GGGGGTGTTGGTAATGGGGGAGG - Intergenic
902070855 1:13735652-13735674 TAGGATGTTGATAATGGGGAAGG - Intronic
902424928 1:16312726-16312748 GGGGATGTTGATAATGGGAGAGG + Intronic
903819624 1:26092069-26092091 GGGGATGTTGATAGTCGGGGAGG + Intergenic
904325099 1:29723224-29723246 GGGGATGGTGATAATGGTGGTGG - Intergenic
904524479 1:31122456-31122478 GGAGATGTTCATTGTTGGGTGGG + Intergenic
905245223 1:36608268-36608290 GGGCATGTACACAAGGGGGTAGG - Intergenic
907090737 1:51723085-51723107 GGGGATGTTGATAGTAGGGGAGG - Intronic
907492570 1:54817512-54817534 CTTGGTGTTCATAATGGGGTTGG + Intronic
907817001 1:57928382-57928404 GGAGATATTGATAATGGGGGTGG - Intronic
907829241 1:58048551-58048573 GGGGATGGTTATAATGGGTTTGG - Intronic
908238107 1:62166799-62166821 GAGGATGTTGATAATGGGAGAGG - Intergenic
908279233 1:62513032-62513054 GGGGATGTTAATAATGGGGGAGG + Intronic
908562594 1:65321611-65321633 GGGGATGTTGATAATGGGAGAGG - Intronic
908674771 1:66591535-66591557 GGGGATGTTGATAATGGGGGAGG - Intronic
908917294 1:69143483-69143505 GGGGATGTTGATAATGGGGAAGG + Intergenic
909186321 1:72491081-72491103 AGGGATGTTGATAATGGAGGAGG + Intergenic
909510361 1:76446265-76446287 ATGGATGTTGATAATGGGGGAGG - Intronic
910136121 1:83972043-83972065 GTGGATGTTGATAATGGGGGAGG - Intronic
910372556 1:86532065-86532087 AGGGATGTTGATAACGGGGAAGG - Intergenic
910767946 1:90801289-90801311 TGGGATGTTGAGAATGGGGGAGG - Intergenic
910804035 1:91172944-91172966 AGGAATGTTGATAATGGGGGAGG + Intergenic
910997525 1:93123874-93123896 AGGGATGTTGATAATGGAGGAGG - Intronic
911078355 1:93902596-93902618 GGGTATGTTGATAATGGGGGAGG - Intronic
911324522 1:96454424-96454446 GGGGATGTTGATAGTGGGAGAGG - Intergenic
911390628 1:97236810-97236832 GGGAATGTTGATAATGAGGGAGG + Intronic
911471340 1:98322583-98322605 GGAGATGTTGATAATAGAGTAGG + Intergenic
911664342 1:100537140-100537162 GGGGATTTTGATAATGGGAGAGG - Intergenic
911809607 1:102258599-102258621 GAGGATGTTGATAATGGTGGAGG + Intergenic
911813745 1:102315828-102315850 AGGGAGGTTGATAATGGGGAAGG + Intergenic
911999611 1:104814814-104814836 GGGGATGTTGTTAATGGGAGAGG + Intergenic
912010916 1:104961201-104961223 GAGGATGTTGATAATGGGGAAGG + Intergenic
912346954 1:108972526-108972548 GGGGATACTGATAATGGGGGAGG + Intronic
912479624 1:109971440-109971462 AGGGATGTTCATGGTGGGGGAGG + Intergenic
912529251 1:110308180-110308202 GTGGATGGTCATAATGAGGAAGG - Intergenic
912970844 1:114281593-114281615 GGGGATGTTGATAATGGGGGAGG + Intergenic
913235476 1:116777469-116777491 GGGGATGTTGATAATGGGGAAGG + Intergenic
913404967 1:118480240-118480262 GGGGGTGTGCATAATGGGGGAGG + Intergenic
913571132 1:120121024-120121046 GGGGATGTTGATAATGGAGAGGG - Intergenic
914291942 1:146282002-146282024 GGGGATGTTGATAATGGAGAGGG - Intergenic
914552986 1:148732785-148732807 GGGGATGTTGATAATGGAGAGGG - Intergenic
916004209 1:160644964-160644986 GGGGATATTGATAATAGGGGAGG + Intronic
916554054 1:165877913-165877935 GGGGGTGTTGATAATAGGGGAGG - Intronic
916938080 1:169651433-169651455 GCAGATGTTGATAATGGGGGAGG + Intergenic
917063144 1:171062895-171062917 GGGGATGTCGATAATGGGGGAGG - Intronic
917322020 1:173792476-173792498 GGGAATGTTGATAATGGGTGAGG + Intergenic
917875690 1:179285021-179285043 GGGGATTTTGACAATGGGGGAGG + Intergenic
917892918 1:179456597-179456619 GGGGATGGCTATAATGGGTTTGG - Intronic
918321779 1:183371524-183371546 GGGGATGTTGATAATGGGCAAGG + Intronic
918334857 1:183498688-183498710 GGGAATGTTCATAACAGGGGAGG - Intronic
918557618 1:185822267-185822289 GGGGATGTTGATAATGGCGGAGG + Intronic
918833936 1:189435285-189435307 AGGGATGTTGATAATGGAGAAGG + Intergenic
918979733 1:191540647-191540669 GGGGATGTTGATAATGGGAGAGG - Intergenic
919153299 1:193727826-193727848 GGGGATGTCAATAATAGGGGAGG + Intergenic
919794896 1:201315636-201315658 GGGAATGTTCATAGTGGAGCCGG + Intronic
919811737 1:201412989-201413011 GGGCATGGCCATAATGGGTTGGG - Intronic
920084873 1:203408018-203408040 GGGGATGTTGATAGTTGGGGAGG - Intergenic
920162217 1:204007737-204007759 TGGGATGTTAATAATGGGGGAGG + Intergenic
920743775 1:208606355-208606377 GGGAATGTTGATAATGGAGGAGG - Intergenic
920985171 1:210882090-210882112 GGGGATATTGATAATGGTGGAGG + Intronic
921316366 1:213895219-213895241 GGTGATGGTGATGATGGGGTAGG + Intergenic
921607828 1:217175975-217175997 GGGGATGTTGGTAATAGGGGAGG - Intergenic
921790858 1:219288715-219288737 GGAGATGTTGACAATGGGGAAGG + Intergenic
922181318 1:223235291-223235313 GGGGATGTGAATAATGGGGGAGG - Intronic
922272635 1:224048241-224048263 GGGAATGTTGACAATGGGGAAGG + Intergenic
922318297 1:224462097-224462119 GCGGATGGTGATAATGGGGGAGG - Intronic
923549583 1:234952766-234952788 GGGGATGTTGACAGTGGGGAAGG - Intergenic
1062778332 10:175163-175185 TGGGATGTTGATAATAGGGGAGG + Intronic
1063547637 10:6997938-6997960 GGGGATGTTAATACTGGGTGAGG - Intergenic
1063650987 10:7936612-7936634 GGGGATGTTGATAGTGGGGGAGG - Intronic
1063894986 10:10670527-10670549 GGGGATGCTGATAATGTGGGAGG - Intergenic
1064789927 10:18946001-18946023 GGGGATGTTGATATTGGAGGAGG - Intergenic
1064933810 10:20657473-20657495 GGGGATGCTGATAGTAGGGTAGG - Intergenic
1065818643 10:29505737-29505759 GGGGATGTTGATAATTGGGGTGG + Intronic
1065828555 10:29594477-29594499 GGGGATGTTGATAGTAGGGGAGG + Intronic
1065954277 10:30678659-30678681 GGGGATGTTGATAATTGGGGTGG - Intergenic
1066511558 10:36104083-36104105 GGGGATGTTGATAGTGAGGGAGG + Intergenic
1066552793 10:36577989-36578011 GGGAACGTTGATAATGGGGGAGG - Intergenic
1067397457 10:45935439-45935461 GGGGATGTTGATAATGGGGGAGG + Intergenic
1067529164 10:47057999-47058021 GGAGATGTTGATAATGGGGGAGG + Intergenic
1067865775 10:49904525-49904547 GGGGATGTTGATAATGGGGGAGG + Intronic
1068590921 10:58852228-58852250 AGGGATATTGATAATGGGGGAGG + Intergenic
1068868297 10:61917743-61917765 GGGGCTGTTAAAAATGGGGTGGG + Intronic
1069107296 10:64398568-64398590 GAGGATGTTGATAATGGGGGAGG - Intergenic
1069149136 10:64933732-64933754 GGGGATGTTGATAATGTGGGAGG - Intergenic
1069508612 10:69023309-69023331 GAGGATCTTCATAAGGCGGTCGG - Intergenic
1069691015 10:70352635-70352657 GGGGATGTTGATCATGGAGAAGG + Intronic
1069847302 10:71381260-71381282 GGGGATGTTGATACTGTGGCAGG + Intergenic
1070204293 10:74241306-74241328 GGGGATGCTGAAAATGGGGGAGG - Intronic
1070412871 10:76160085-76160107 GGGGATGTTGATAAGGGGGGAGG + Intronic
1070852594 10:79579259-79579281 GGGGATGTTCATAATGAGGGAGG + Intergenic
1071585114 10:86812734-86812756 GGGGATGTTGAGAGTGGGGCAGG - Intronic
1071709275 10:88033544-88033566 GGAAATGTTGATAATGGGGGAGG - Intergenic
1072976794 10:100065811-100065833 TGGGATGTTGATGGTGGGGTGGG + Intronic
1073638512 10:105224016-105224038 GAGGATGTTGATAATGGAGGAGG - Intronic
1074146620 10:110722349-110722371 GGGGATGCTGATAATGGGGGAGG - Intronic
1074562937 10:114550486-114550508 GGGGATGTTGCTAATGGGGGAGG - Intronic
1075447438 10:122523498-122523520 AGGGATGTTGATAATGGGGGCGG + Intergenic
1076082092 10:127591443-127591465 GAGGATGTTGATAATGGGGAGGG + Intergenic
1077382310 11:2249899-2249921 GGGGGGGATCATAATGGGGTGGG - Intergenic
1077492520 11:2868658-2868680 AGGGATTTTCATAGTTGGGTTGG + Intergenic
1079684784 11:23345322-23345344 CGGGATGTTAATAATGGAGTCGG + Intergenic
1079953477 11:26833488-26833510 TGGGATGTTGATAGTGGGGAAGG - Intergenic
1080395223 11:31883662-31883684 GGGCATGTTGATGATGGGGGAGG + Intronic
1080798429 11:35587514-35587536 GGGGATGTTGATAGTGGGGGAGG - Intergenic
1081459542 11:43259222-43259244 GGGGATGTTGATAATGGGAGAGG + Intergenic
1082192326 11:49261592-49261614 GGGGATGTTGATAATTGGGGAGG - Intergenic
1083073625 11:60014026-60014048 GGGGGTGTTGATAATGAGGAAGG - Intergenic
1084924194 11:72498835-72498857 GGGGATGTTGATAATGGGGGAGG - Intergenic
1085963219 11:81488493-81488515 GGGGATGTTGATAAAGAGGGGGG - Intergenic
1086326391 11:85705513-85705535 TGGGATGTTGATAGTGGGGGAGG - Intronic
1086478247 11:87203136-87203158 CGGGATGTTAATAATGGGGGAGG - Intronic
1086663159 11:89446936-89446958 GGGGATGTTGATAATGGGGGAGG + Intronic
1086673799 11:89579367-89579389 GGGGATGTTGATAATTGGGGAGG + Intergenic
1087055568 11:93932618-93932640 GGGGAAGCTGATAATGGGGGAGG + Intergenic
1087097651 11:94335108-94335130 GGGGATGTTGATCATGAGGGAGG - Intergenic
1087803806 11:102533892-102533914 AGGGATGTTGATAATGGGGGAGG + Intergenic
1087955529 11:104282231-104282253 GAGGATGTTGATAATGGAGGAGG - Intergenic
1087987554 11:104703460-104703482 GGGGATATTGATAATGGGAAAGG - Intergenic
1088991625 11:114958903-114958925 GAGGATGTTGATAGTGGGGAAGG + Intergenic
1089438972 11:118498656-118498678 GGGGATGCTGATCATGGGGGAGG - Intronic
1089576225 11:119446295-119446317 GGGGATGTTGATGATGGGGGAGG + Intergenic
1091454462 12:596429-596451 GGGGATGTTGATAATGGGGGCGG + Intronic
1092052001 12:5478343-5478365 GGTGATGTTAATAATGTAGTTGG - Intronic
1093176907 12:15922890-15922912 GGGGATGTTGATAATGGGGGAGG + Intronic
1093214156 12:16343484-16343506 GTGGTTGTTTCTAATGGGGTGGG - Intergenic
1093591620 12:20908311-20908333 GGAGATGTTGATAATGGGGAAGG - Intronic
1094165087 12:27435374-27435396 GGGGTTCTTCATTATGGGGGCGG - Intergenic
1094215341 12:27935021-27935043 GGGGATGTTGATAATGGGGAAGG + Intergenic
1095681349 12:44980139-44980161 GGGGATGTTGATACTGGGGGAGG - Intergenic
1096970555 12:55662957-55662979 GGGGATGTTCATAGGGGGCTTGG - Intergenic
1098069356 12:66655410-66655432 TGGGATGTTGATAGTGGGGGAGG - Intronic
1098085290 12:66835929-66835951 GGAAATGTTTATAATGGGGGAGG + Intergenic
1098656392 12:73035689-73035711 GAGGATGTTGATACTGGGGGAGG - Intergenic
1098710998 12:73761623-73761645 GGGGATGTTAATAATAGGAGAGG - Intergenic
1099242396 12:80153481-80153503 GGGGATGTTGATAATGAGAGAGG - Intergenic
1100642993 12:96500501-96500523 GGAGATGTTGATAATGGGGAGGG + Intronic
1100852822 12:98731247-98731269 GGGGATGTTCATAATGGAAGAGG - Intronic
1100911764 12:99372190-99372212 GGGGATGTTCATGATGGGGGAGG + Intronic
1100992091 12:100262096-100262118 CAGGATGTTGATAATGGGGAAGG + Intronic
1101229134 12:102721941-102721963 GGGGATGTGAATTATGGGATGGG - Intergenic
1101649435 12:106661474-106661496 AGGGATGTTGTTAATGGGGGAGG - Intronic
1101849341 12:108389708-108389730 GGGGATGATAATAATGGTGATGG - Intergenic
1101872617 12:108578561-108578583 GGGGCTGGTGATAATGGGGCTGG - Intergenic
1102203025 12:111070542-111070564 GGAGATGCTGATAATGGGGGAGG - Intronic
1102447373 12:113014012-113014034 GGGGAAGGCTATAATGGGGTGGG + Intergenic
1103275632 12:119709360-119709382 GGGGATGTTGGTAGTGGGGGAGG + Intronic
1104148948 12:126063439-126063461 AGGGATGTTGATATTGGGGAAGG - Intergenic
1104182958 12:126399914-126399936 GTGGATGTTGATAGTGGGGGAGG + Intergenic
1104392669 12:128404298-128404320 GGGGTTATTCTAAATGGGGTAGG - Intronic
1104416940 12:128603317-128603339 AGGGGTGTGCATACTGGGGTGGG + Intronic
1105266968 13:18828636-18828658 GGGCATGTGCATCATGGGGTTGG - Intergenic
1105654266 13:22418484-22418506 GAGGAGGTTGATAATGGGGAGGG + Intergenic
1105964838 13:25374199-25374221 GGAGATGTTCAGGAAGGGGTGGG + Intronic
1107160273 13:37217642-37217664 GGGGATGATGATGATGGGGAAGG - Intergenic
1107995347 13:45854002-45854024 GGGGGTGTTGATAATAGGGGAGG - Intergenic
1108103376 13:46982458-46982480 GGGGGTGTTGATAATGGAGGAGG - Intergenic
1108316129 13:49239354-49239376 GGGGATGTTAATAGTTGGGGAGG + Intergenic
1109413761 13:62008755-62008777 GGGAATATTGATAATGGGGATGG - Intergenic
1109461802 13:62669842-62669864 GGGTATGTTCATGAAAGGGTTGG + Intergenic
1109988450 13:70020960-70020982 GGGGATGTTGATAATAGGGGAGG - Intronic
1110202959 13:72874857-72874879 GGGGATGTTCATAATGGGGTAGG - Intronic
1110305241 13:73979230-73979252 GGGTATGTTGATAATGGGAGAGG + Intronic
1110314627 13:74091875-74091897 GGGGATGTTGATAATGAAGGAGG + Intronic
1110458594 13:75718571-75718593 GGGGACGTTGATAATGGGGGAGG - Intronic
1110753432 13:79143103-79143125 TGGGATGTTGATAGTGGGGGAGG - Intergenic
1110782290 13:79480721-79480743 GGGGATGTTGATAATGGTGGGGG + Intergenic
1110783973 13:79501367-79501389 GGGGATGTTGTTAATGGGGGAGG + Intronic
1110873496 13:80480398-80480420 GGGGATGCTGATAATGGGGGAGG - Intergenic
1110903316 13:80852843-80852865 GGGGATGTTGATAAAGGGGAAGG - Intergenic
1111363926 13:87215307-87215329 GGGGATGTTGATAATAGGAGAGG + Intergenic
1111599957 13:90460382-90460404 GGGGATGCTGATAATGGGGGAGG - Intergenic
1112240983 13:97680719-97680741 GGAGATGTTGATAATGGGGGAGG - Intergenic
1112833335 13:103480238-103480260 GGGGATGTTGATAGTTGGGGAGG + Intergenic
1113237588 13:108297745-108297767 GGGGATTTTGATAATGGGGGAGG - Intronic
1113971290 13:114192289-114192311 GGGCATGTTGATAATGGGGGAGG + Intergenic
1114239431 14:20852651-20852673 GGGGATGTCGATAATGGGGGAGG + Intergenic
1114358600 14:21943494-21943516 GTGGATGTTGATAATGGGAGAGG - Intergenic
1114546165 14:23503216-23503238 GGGGATGTTGATAATGGGGGAGG - Intronic
1114752183 14:25217406-25217428 GGGGATATTGACAATGGGGGCGG + Intergenic
1116218037 14:42045505-42045527 GGGGATGTTGATAATGGGGGAGG - Intergenic
1116276223 14:42836141-42836163 GGGAATGTTGATAATGGGGGAGG + Intergenic
1116723338 14:48528898-48528920 GGGGATGTTGAAAATGGGTGAGG - Intergenic
1117625417 14:57632576-57632598 GGGAATGTTGATAATGGGGGAGG - Intronic
1117794352 14:59376871-59376893 GGGGATGTTGATAATAGGGGAGG + Intergenic
1117927996 14:60805339-60805361 CAGGATGTTAATAATGGGGGAGG - Intronic
1118066160 14:62193059-62193081 GGGGATGTTGGTAATGGGACAGG - Intergenic
1118177121 14:63451783-63451805 GGAGGTGTTGATAATGGGGGAGG + Intronic
1119028941 14:71176415-71176437 GGGGATGTGGATAATGGGGGAGG - Intergenic
1119197743 14:72729983-72730005 GAGGATGTTGATCATGGGGGAGG + Intronic
1119651001 14:76382644-76382666 TGGGATGTTCACTATGGAGTTGG + Intronic
1120214886 14:81670639-81670661 GAGGATGTTTACCATGGGGTAGG + Intergenic
1120751842 14:88204822-88204844 TGGGATGTTGATAGTGGGGAAGG - Intronic
1120837519 14:89054763-89054785 GGGGATGTTGATAATGGGGGAGG + Intergenic
1120856449 14:89216788-89216810 GTGGATTTTCATTAAGGGGTGGG - Intronic
1121049639 14:90812066-90812088 GCACATGGTCATAATGGGGTTGG - Intronic
1122360306 14:101156009-101156031 GGGGATGCTGATAATGTGGGAGG - Intergenic
1122405186 14:101496571-101496593 GGGGGTGTTCATGACGGGGGAGG + Intergenic
1122746650 14:103901039-103901061 GGAGCTGTTCATCATGGGGTGGG + Intergenic
1123222013 14:106866152-106866174 GGTGATGTTCAGAATAGGATTGG + Intergenic
1123972781 15:25524470-25524492 GGGGATGTTGATGATGGGGGAGG + Intergenic
1124080311 15:26488229-26488251 GGGGATGTTGATAGTGAGGGAGG + Intergenic
1124723957 15:32138463-32138485 GGGGATGTTGATGATGGGGGAGG - Intronic
1125060346 15:35413045-35413067 GGGGAGGTTGATAATGGGGGAGG + Intronic
1125234361 15:37495388-37495410 GGGGATGTTGATAATGGAGGAGG - Intergenic
1125262383 15:37842100-37842122 TGGGATGTTGATAGTGGGGCAGG - Intergenic
1125278217 15:38016122-38016144 GGGGGTGTTGATAATGGGGGAGG + Intergenic
1125278820 15:38022718-38022740 GGAGATGTTGATAATGGGGGAGG + Intergenic
1126017427 15:44365899-44365921 GGGGATGTTAATAATCGGGGAGG + Intronic
1126206731 15:46053824-46053846 GGGAATGTTGATAATAGGGGAGG - Intergenic
1126298820 15:47171845-47171867 AGGGATGTTAATAATGGGAAAGG - Intergenic
1126310676 15:47313056-47313078 GGAGATGTTGACAATGGGGGAGG - Intronic
1126379702 15:48033658-48033680 GGAGATGTTGACAATGGGGGAGG + Intergenic
1126408334 15:48345927-48345949 GGGGATGCTGATAATGGAGGGGG - Intergenic
1127068042 15:55260989-55261011 TGGGATGTTGATAGTGGGGGAGG + Intronic
1127681268 15:61300804-61300826 GGGGATGTTACTAATCGGGGAGG + Intergenic
1128023183 15:64411370-64411392 AGGGATGCTAATAATGGGGGAGG + Intronic
1130041522 15:80409005-80409027 GGGAATGTTGATCATGGGGGAGG - Intronic
1130194661 15:81768180-81768202 GGGGATGTTGTTAATGAGGGAGG + Intergenic
1131232223 15:90667561-90667583 GGGGATGTTAATCATCGGGGAGG + Intergenic
1131569178 15:93516168-93516190 GGTGATGATCAAAATGGGATGGG + Intergenic
1132694214 16:1194840-1194862 GGGGGTGTCCAGGATGGGGTGGG - Intronic
1133734498 16:8603869-8603891 GGGGATGCTGATAATGGGAGAGG - Intergenic
1134664234 16:16006959-16006981 GGTGATGGTCATAGTGGGGAAGG + Intronic
1134772207 16:16819078-16819100 GGGGATGTTGATAATAAGGGAGG - Intergenic
1135433621 16:22409030-22409052 GGGGATGTTGACAATGGGGGAGG - Intronic
1135777537 16:25269817-25269839 GGGAAAGTTTATCATGGGGTTGG - Intergenic
1135778219 16:25275794-25275816 GGGGATGTCGATCATGGGGGAGG + Intergenic
1135839399 16:25860929-25860951 GGGGATGCTGATAATGAGGGAGG + Intronic
1136108085 16:28045277-28045299 GGAGATGTTGATAATGGGAGAGG + Intronic
1137238647 16:46636272-46636294 GGGGCTGTTGATAATGGGGGAGG + Intergenic
1137426056 16:48381918-48381940 GGGAATGTTGATAATGGAGGAGG + Intronic
1138356123 16:56381882-56381904 AGGGATGTTGATAATGGGGAAGG + Intronic
1138423475 16:56914951-56914973 GGGGCTGTTAAGAGTGGGGTTGG + Exonic
1138490263 16:57372450-57372472 GTGGCTTTTTATAATGGGGTTGG - Exonic
1138546782 16:57724410-57724432 GCAGATGTTCATCATGGTGTTGG + Intronic
1139608947 16:68040805-68040827 GTGGATGTTCTTACTGGGGGTGG + Intronic
1139845257 16:69916503-69916525 GGGGAGGTTAATTCTGGGGTAGG + Intronic
1140697436 16:77548903-77548925 GGGGATGTTTATAGTGAGGAAGG - Intergenic
1141397244 16:83716200-83716222 GGGGATATTGATTATGGGGGAGG - Intronic
1142821628 17:2473055-2473077 GGGGATGCTGATAATGGAGAAGG + Intronic
1144149138 17:12426646-12426668 GAGAATGTTCATAATCGGGGAGG + Intergenic
1145108254 17:20138319-20138341 GGGGATGTTGATAATGGGAGAGG - Intronic
1145229378 17:21161260-21161282 AGGGATGTGGATAATGGGGGAGG + Intronic
1146091142 17:29879491-29879513 GGAGATGTTGATAATGGGGGAGG - Intronic
1146759669 17:35466081-35466103 GGAGATGTTGCTAATGGGGGAGG - Intronic
1148023166 17:44567003-44567025 AGGGATGTTGATAATGGGGAAGG - Intergenic
1149457321 17:56798414-56798436 GGGGATGTTGGTAGTGGGGGAGG - Intronic
1149999376 17:61423925-61423947 GGGGATGTTGAAAATGGGGGAGG + Intergenic
1150061082 17:62068678-62068700 GGGGATGTTGATAATGAGGGAGG + Intergenic
1150680988 17:67284326-67284348 GGGGATATTGATAATGGGGGAGG + Intergenic
1150688199 17:67337703-67337725 GGGGATGTTGACAATGAGGGAGG + Intergenic
1150865856 17:68849365-68849387 GGGGATGTGGATGATGGGGGAGG + Intergenic
1150878570 17:68997728-68997750 GGGAATGTTAATAATGGCGGAGG - Intronic
1151087429 17:71396958-71396980 GAGGATTTTGATAATGGGGGAGG + Intergenic
1151516031 17:74596513-74596535 GGGGATGTTGATAATGGGGGAGG - Intergenic
1151532925 17:74718963-74718985 GAGGGTGTTGATAATGGGGAAGG + Intronic
1152659344 17:81535258-81535280 GGGGATGGTGATGATGGGGATGG - Intronic
1152659397 17:81535417-81535439 GGGGATGGTGATGATGGGGATGG - Intronic
1153404999 18:4727852-4727874 TGGGATGTTGCTAATGGGGGAGG + Intergenic
1153571020 18:6473731-6473753 GGGAATGTTCAGAAAAGGGTTGG - Intergenic
1154398659 18:14013689-14013711 GGGGATGTTGATAGTGGGGGAGG - Intergenic
1154421442 18:14232801-14232823 AGGCATGTGCATCATGGGGTTGG + Intergenic
1155564369 18:27117341-27117363 AGGGATGTTGAAAATGGGGGAGG - Intronic
1155764409 18:29609615-29609637 GAGGATGTTCATAATGGAGGCGG - Intergenic
1155856013 18:30835467-30835489 GAGAATGTTGATAATGGGGAAGG + Intergenic
1156248551 18:35328208-35328230 GGGGATGTTGACAATGGAGGAGG - Intergenic
1157503906 18:48212549-48212571 GGGGATGTCAATAATGTGGGAGG + Intronic
1158420934 18:57293349-57293371 GGGGATGTTGATAATGGGAAAGG - Intergenic
1158730956 18:60022036-60022058 GGGGATGTTGGTAATGGGGGAGG - Intergenic
1159326181 18:66922264-66922286 GGGGATGCTAATAATGGGAGAGG - Intergenic
1159736511 18:72105611-72105633 TGGAATGTTGATAATGGGGGAGG + Intergenic
1159777344 18:72618985-72619007 GGGGATGGTCATCATGGATTTGG + Intronic
1159818288 18:73105593-73105615 GGGGATGTTGATAATGGAGGAGG - Intergenic
1162932733 19:13965470-13965492 GGGGATGTTGACCATGGCGTGGG + Exonic
1164665475 19:30030741-30030763 GGGGATGTTGATGATAGGGGAGG - Intergenic
1164753180 19:30670948-30670970 AGGGATGGGCAGAATGGGGTGGG - Intronic
1164894352 19:31858257-31858279 GGGGTTGTTAACAATGGGGGAGG + Intergenic
1164969052 19:32514931-32514953 GGGGATGTGAATAATAGGGGAGG + Intergenic
1165613924 19:37182047-37182069 GGGGATGTTGATGATGGGGGAGG + Exonic
1165752967 19:38272263-38272285 TGGCATGTTCTTAAAGGGGTGGG + Intronic
1165808427 19:38596141-38596163 GGGGAGATTGATGATGGGGTGGG - Intronic
1167764947 19:51475856-51475878 GGGGCTGTTGATAATGGGGGTGG + Intergenic
1167804705 19:51772899-51772921 GGGGATGTTGATAATGAGAGGGG - Intronic
1167839990 19:52107979-52108001 GAGGATGTTGACAATGGGGAAGG + Intergenic
1167975066 19:53219540-53219562 TGGGTTGTTAATAATGGGGGAGG - Intergenic
1168329324 19:55557551-55557573 GGGGATGTTGATAGTGGGGGAGG - Intergenic
1168388056 19:55982595-55982617 GGGAATGTACAGAATGGGCTTGG + Intronic
924971839 2:135583-135605 GGTGATGTTGATAATGGGGGTGG + Intergenic
925471445 2:4165734-4165756 GGGGATGTTGCTAATGTGGGAGG - Intergenic
925483001 2:4297323-4297345 TGGGATGTTGATAATGGAGAAGG - Intergenic
926204728 2:10828037-10828059 TGGGATGTTGATAGTGGGGAAGG - Intronic
926604077 2:14878735-14878757 GGGGATGTTGATAGTTGGGGAGG - Intergenic
926780874 2:16470770-16470792 GGGGATGTTGATAATGGGGGAGG + Intergenic
927580084 2:24235538-24235560 GGGGTTGTTGTTAATGGGGGAGG + Intronic
928020766 2:27703036-27703058 GGGAATGTTGATAATGGGGGAGG - Intergenic
928788389 2:34918990-34919012 GGAGATGTTGACAATGGGATAGG - Intergenic
929095323 2:38258178-38258200 GGGGATGTTGATAGTGGGGTGGG - Intergenic
929344844 2:40869426-40869448 CGGGATGTTGATAATGGGAGAGG - Intergenic
930492996 2:52100328-52100350 GGGGATGTTCGTAATGGGAAAGG - Intergenic
930941164 2:57015792-57015814 GGAGATGTCAATAATGGGGGAGG + Intergenic
931050504 2:58408532-58408554 GGTGATATTGATAATGGGGGAGG + Intergenic
931131712 2:59343521-59343543 GGGGATGTTGATAATAGCGGAGG - Intergenic
932470722 2:71953602-71953624 GGGGATGTTGATAATGAGGAAGG - Intergenic
932488920 2:72106071-72106093 GGGGATGTTAATAATGGGGGAGG - Intergenic
932923764 2:75946404-75946426 GGGGATGTTGACAATGGGGGAGG - Intergenic
933531130 2:83513740-83513762 GTGGATGTTGATAATGGGGGAGG + Intergenic
933572182 2:84026611-84026633 GGAGATGTTCACCTTGGGGTAGG + Intergenic
935195858 2:100815725-100815747 GGGGATGCTGATAGTGGGGGAGG + Intergenic
935209245 2:100924179-100924201 GGGGATGCTGATAATGGGGGAGG - Intronic
936692127 2:114902730-114902752 GGGAGTGTTTATAATGGGGAGGG - Intronic
936919414 2:117672212-117672234 GGGGATGTTGATAATGGGGGAGG + Intergenic
937291592 2:120785290-120785312 TGGGATCTTCATGATGAGGTAGG - Intronic
937857740 2:126684741-126684763 GGGGATGCTCATAATTGTGCCGG - Intronic
937918327 2:127111764-127111786 GGGGATGTTGATAGTGAGGGGGG - Intergenic
938193953 2:129309492-129309514 GGAGGTGTTGATAATGGTGTTGG + Intergenic
938221893 2:129576041-129576063 GGGAATGTGGAAAATGGGGTTGG - Intergenic
938826761 2:135013392-135013414 GGCGATGTTAATAATGGGTGAGG - Intronic
938970704 2:136428713-136428735 GGGAATGTTGACAATGGGGGAGG - Intergenic
939237107 2:139508960-139508982 CGGGATGGTCATAATGGGAGAGG + Intergenic
939857850 2:147382033-147382055 TGGGATGTTGATAATTGGGGAGG + Intergenic
940181668 2:150941271-150941293 GGGGATGTTGCTAATGAGGGAGG + Intergenic
940878750 2:158924561-158924583 GGGGATGTTCATATTTGGGGAGG - Intergenic
940996479 2:160155516-160155538 GGAGATGATGATAATGGGGAAGG + Intronic
941089553 2:161159283-161159305 AGGGATGTTGATAATGGGGAAGG + Intronic
941242425 2:163055924-163055946 GGGAATGTTAATAATGAGGAAGG - Intergenic
941508625 2:166377487-166377509 GGGAATGTTGATAATGGGGGAGG - Intergenic
941603605 2:167567665-167567687 GGGGATGTTGATAACGGGGAAGG - Intergenic
941668389 2:168264064-168264086 GGAGATGTTGATAATGGGAGAGG - Intergenic
941717429 2:168778834-168778856 GGTGATGTTGATAATGGGGGAGG + Intergenic
941733400 2:168945179-168945201 GGAGATGTTGATAATGGGGGAGG + Intronic
941992951 2:171574801-171574823 GGGAATGTTGATAAGGGGGGAGG + Intergenic
942287018 2:174429555-174429577 TGGGATGTTGATAGTGGGGGAGG - Exonic
942530890 2:176909129-176909151 GGGGATGTTGATAATGGAGGAGG + Intergenic
942531870 2:176919044-176919066 GGGGTTGATCATATTGTGGTTGG - Intergenic
942573785 2:177341015-177341037 GGAGATATTGATAATGGGGTAGG + Intronic
942720198 2:178942720-178942742 GGGGATGTTGATTATGGGGGAGG + Intronic
942761712 2:179406571-179406593 GGGGATGTTGATAATAGGGAAGG - Intergenic
942919028 2:181348300-181348322 GGGGATGTTGATAATGGGGGAGG + Intergenic
942991264 2:182206333-182206355 GGGGATGTTGACAATGGGGGAGG - Intronic
943032005 2:182696679-182696701 GGGGATGTTGACAATGGGGGAGG + Intergenic
943295945 2:186139189-186139211 GGGGATGGACATTCTGGGGTTGG + Intergenic
943562206 2:189477418-189477440 AGAGATGTTGATAATGGGGTAGG - Intergenic
943642687 2:190376395-190376417 TGGGATGTGCAGGATGGGGTGGG - Intergenic
944443435 2:199765308-199765330 GGGAATGTTGATAATGGGGTAGG + Intronic
944461273 2:199953395-199953417 GGGGATGTTGATCATGGAGGAGG + Intronic
944476093 2:200108208-200108230 TGGGATGTTGATAGTGGTGTTGG + Intergenic
944726795 2:202479555-202479577 GGGAATGTTGATAATGGGGGAGG - Intronic
945536869 2:211028062-211028084 GGGGATGTTGTTAATGGGGAAGG - Intergenic
945712625 2:213317846-213317868 GGGGCTATTGATAATGGGGAAGG + Intronic
946671748 2:222112137-222112159 GAGGATGTTGATAATGGGGGAGG + Intergenic
946750201 2:222886848-222886870 GGGGATGTTGATAAAGAGGGAGG - Intronic
946768959 2:223068391-223068413 GGGTATTTTCATAATGAAGTCGG + Intronic
947039289 2:225896843-225896865 GGGGATGTTGATAATAAGGGAGG + Intergenic
948383558 2:237567715-237567737 GGGGGTGTTGATCATGGGGGAGG - Intergenic
1170099759 20:12686165-12686187 GGGGATGATCATCATGGTATGGG - Intergenic
1170205894 20:13797791-13797813 GGAGATATTGATAATGGGGGAGG + Intronic
1170417042 20:16155675-16155697 GAGGATGTTCATAATGGGGGAGG + Intergenic
1170651476 20:18246493-18246515 GGGGATGTTAATAATGGGGGAGG - Intergenic
1170880294 20:20291094-20291116 GGGGATGTTGATAGTGGGGGAGG - Intronic
1171384522 20:24761156-24761178 TGGGATGTTGATAATGGGGAAGG + Intergenic
1171415475 20:24977237-24977259 GGGGATGTTGATCATGTGGGAGG + Intronic
1171433646 20:25103292-25103314 GGAGAAGTTTATGATGGGGTCGG - Intergenic
1172077065 20:32307151-32307173 GGAGATGTCCATAATGGGGGAGG - Intronic
1172898118 20:38314818-38314840 GGGGATGATGATAATGGTGATGG + Intronic
1173234358 20:41230798-41230820 GGGAATGTTGATAATGGAGTAGG - Intronic
1175326787 20:58135140-58135162 GGGGATGTTGATAGTGAGGGAGG + Intergenic
1175511604 20:59531529-59531551 GGCGATGTTGATAATGGGGGAGG + Intergenic
1175552626 20:59827139-59827161 GGGCATGTTCACGGTGGGGTTGG + Intronic
1175698439 20:61120197-61120219 GGGGATGTTGATAACAGGGGAGG + Intergenic
1176852031 21:13927149-13927171 AGGCATGTGCATCATGGGGTTGG - Intergenic
1176889148 21:14293371-14293393 GAGGATGTTGATAATGGGGGAGG + Intergenic
1177001123 21:15614493-15614515 GGGGATGTTGATAATGGGGAAGG + Intergenic
1177468873 21:21528407-21528429 GGAGATGTTGCTAATGGGGGAGG + Intronic
1177670000 21:24212646-24212668 GGGGATGTTGATAATAGGGGAGG + Intergenic
1177826753 21:26092740-26092762 GGGGATGTTTATAATAGGAGAGG + Intronic
1178101698 21:29275856-29275878 GGGGATGTCAATAATGGTGGAGG - Intronic
1178381157 21:32110040-32110062 GGGGATGTTGATAATGGGGAAGG + Intergenic
1178594984 21:33945220-33945242 GGGGACGTCCATAGTGGGGGAGG + Intergenic
1179057541 21:37949953-37949975 GGGGATGTTGATAGTGGGGGAGG + Intergenic
1179154921 21:38841301-38841323 GGGGCTGTTCACAAAGGTGTGGG - Intergenic
1179192626 21:39136353-39136375 GAGGATGTTGATAATGGCGGAGG + Intergenic
1179227644 21:39469198-39469220 GGGGATGTTGATAATGGGGGAGG - Intronic
1179300492 21:40104760-40104782 GGGGATGTCGATAGTGGGGGAGG + Intronic
1179595951 21:42443431-42443453 GGGGCTGTTCATACTGAGGATGG - Intronic
1180019330 21:45111396-45111418 ACGGATGTTGATAATGGGGGAGG - Intronic
1180781225 22:18520981-18521003 GGGGATGATCACAGTGAGGTGGG - Intergenic
1181238110 22:21460323-21460345 GGGGATGATCACAGTGAGGTGGG - Intergenic
1181727535 22:24821856-24821878 GAGGATGTTGACAGTGGGGTAGG - Intronic
1182178562 22:28319540-28319562 TGGGATGTCAATAATGGGGGAGG + Intronic
1183766456 22:39880538-39880560 GGGGATGTTTATAATGGGGGAGG + Intronic
1184215689 22:43065773-43065795 GGGGATGCTGATAAGGGGGGAGG + Intronic
949723658 3:7019233-7019255 GGAGATGTTGATAGTGGGGGAGG - Intronic
950302945 3:11897873-11897895 GGGGAGGTTCATGATGTGGCGGG - Intergenic
952893268 3:38058785-38058807 GGGGACGTTGATAATGGTGGAGG + Intronic
955169778 3:56551907-56551929 GGGGATGTTGACAAAGAGGTAGG - Intergenic
955359205 3:58258555-58258577 GGGGATGTACACCATGGGGGTGG - Intronic
956092567 3:65683354-65683376 GGGGATGTTGATAATGTGGGAGG + Intronic
956115862 3:65917986-65918008 GGGGACGTTGATAATGGGGGAGG + Intronic
956281299 3:67559935-67559957 GGGGATGTTGGTATTGGGGGAGG + Intronic
956508134 3:69964600-69964622 GGGAATGTTGATAATGGGGAAGG - Intronic
956695652 3:71917057-71917079 GGGGAATTTCAGAATTGGGTTGG + Intergenic
956771426 3:72529291-72529313 GGGGATGTTGATAGTGGGGGAGG + Intergenic
957676423 3:83372770-83372792 GGGGATGTTGATAATGGGAGAGG + Intergenic
957711927 3:83872327-83872349 GGGAATGTTGATAATGGGAGAGG + Intergenic
957901756 3:86503333-86503355 AGGAATGTTGATAATGGGGGAGG - Intergenic
958009421 3:87857669-87857691 GGGAATGTTGCTAATGGGGGAGG - Intergenic
958017137 3:87951586-87951608 GGGGATGTTGATAATGGAAGAGG - Intergenic
958591409 3:96163005-96163027 GGAGATGTTGATAATGGGAGAGG + Intergenic
958889974 3:99772514-99772536 CAGGATGTTCATAATGGGGGAGG + Intronic
959243273 3:103828559-103828581 GTGGATGTTTATAATGGGGGAGG + Intergenic
959300375 3:104591911-104591933 GAGGATGTTTATAATGTGGGAGG + Intergenic
959633042 3:108530634-108530656 GGGGATGTTGATAATGGGTGAGG + Intergenic
959778014 3:110192560-110192582 GGGGATATTGATAATGGTGGAGG - Intergenic
959877001 3:111395050-111395072 AGGGATGTTGATAATGAGGGAGG - Intronic
959918211 3:111842352-111842374 GGGGATGTTAATAAGGGGAAAGG - Intronic
959933512 3:112007184-112007206 GGGGATGTTGATAATGGGGAAGG - Intronic
960227254 3:115183316-115183338 GGGGATATTTATAATGGGAGAGG + Intergenic
961370754 3:126428576-126428598 GGGGATGTTGATAGTGGGAGAGG + Intronic
961983353 3:131104564-131104586 TGGAATGTTCAGATTGGGGTGGG + Intronic
962621408 3:137183643-137183665 CGGGGTGTTGATAATGGGGGAGG - Intergenic
962699906 3:137987787-137987809 GGGGATGTTGATAATGGGAGAGG - Intergenic
962992899 3:140595667-140595689 GGGGATGTTGATGATGGGGGAGG - Intergenic
963026035 3:140919751-140919773 AGGAATGTTGATCATGGGGTAGG - Intergenic
963848858 3:150187611-150187633 GGGGATGTTGATAGTTGGGAAGG - Intergenic
964917729 3:161856316-161856338 GGGTATGTTGATAATGGGGGAGG + Intergenic
965641520 3:170833741-170833763 GGGGATGTTGATAATGGGAGAGG - Intronic
966193998 3:177295941-177295963 GGGGATGTTGATAATGGACGAGG - Intergenic
966497558 3:180598506-180598528 GGGGATATTGATAATGAGGGAGG + Intergenic
966611124 3:181868811-181868833 AGAGATGTTCAGCATGGGGTGGG - Intergenic
967224766 3:187280853-187280875 GGACATGTTGATCATGGGGTTGG + Intronic
969109675 4:4836077-4836099 AGGGATGTTGATAATGGTGGAGG + Intergenic
969985232 4:11201958-11201980 GGGGATATTGATAATGAGGTAGG - Intergenic
970146361 4:13040565-13040587 GGGGAAGTTAATAATATGGTAGG - Intergenic
970448531 4:16144323-16144345 GGGGACGTTGATAGTGGGGGTGG + Intergenic
970762384 4:19506668-19506690 GGGGATGTTGTTAATGAGGGAGG - Intergenic
971306065 4:25482717-25482739 GGGAATGTTGATAATGGGGGAGG + Intergenic
971949552 4:33327397-33327419 GGGAATGTTAATAATGGAGGAGG + Intergenic
971991728 4:33906758-33906780 GAGGATGTTGATAATGAGGGAGG + Intergenic
971992682 4:33920363-33920385 GGGGATGTTGATAATGGGGGAGG - Intergenic
973289172 4:48453404-48453426 GGGGATGTTGATAATGGGGGAGG + Intergenic
973930115 4:55783622-55783644 GAGGATGCTGATGATGGGGTAGG - Intergenic
974394026 4:61311950-61311972 TGGGATGTTAATAATGGGGGAGG + Intronic
974489217 4:62543343-62543365 GGGGATGTTGATATTGGAGGAGG + Intergenic
974509581 4:62821262-62821284 GAGGATGTTGATAATAGGGAAGG - Intergenic
974632618 4:64513423-64513445 GGGGATGTTAATAATGGGGGAGG + Intergenic
974670932 4:65029062-65029084 GGGGATATTGATAATGGGAGAGG - Intergenic
975124500 4:70766660-70766682 TGGGATGTTGATAATGAGGGAGG - Intronic
975915984 4:79325866-79325888 GCGGATGTTCATAATGGCAGAGG + Exonic
975977114 4:80112131-80112153 GGGGATGTTGATAGCGGGGAAGG + Intronic
976280620 4:83323381-83323403 GGGGATGTTGATAATGAGGGAGG + Intronic
976409737 4:84699730-84699752 TAGGATGACCATAATGGGGTGGG - Intronic
976650471 4:87428825-87428847 GGGGATGTTGACAATGCGGGAGG - Intronic
977155071 4:93561467-93561489 GGGGATGTTAATAATAAGGGAGG - Intronic
977374720 4:96187452-96187474 GGGAATGTTAATAATGGGCAAGG - Intergenic
977574387 4:98660502-98660524 GGGGATGTTGACAATGGGGGAGG - Intergenic
978033016 4:103959006-103959028 GGGGATGTTGATAATGGAGGAGG + Intergenic
978129552 4:105178629-105178651 TGGGATGTTGATAATGGGGAAGG + Intronic
978243668 4:106547414-106547436 TGGGATGTTGATAATGGGGGAGG + Intergenic
978415645 4:108473082-108473104 GGGGATATTGATAATGGAGAAGG + Intergenic
978686157 4:111446012-111446034 AGGGATGTTGATAATGTGGGAGG + Intergenic
978920043 4:114173172-114173194 GGGGATGTAGATAATAGGGGAGG - Intergenic
979104120 4:116663060-116663082 GGGTATGTTAATAACGGGGAAGG - Intergenic
979162932 4:117486782-117486804 GGGGATGTTAATAATGGGGGAGG - Intergenic
979423476 4:120535024-120535046 GGAAATGTTCATAATGGGAGAGG - Intergenic
980378890 4:131984807-131984829 GGGGACATTGATAATGGGGAAGG - Intergenic
980755648 4:137156524-137156546 GGGGATGTTGATAATGAGAGGGG - Intergenic
980793504 4:137650666-137650688 GGGAACGTTGATAATGGGGGAGG + Intergenic
981509854 4:145544166-145544188 GGGGATATTAATAATGAGGGAGG + Intronic
982033855 4:151326248-151326270 GGGGATGTTGATAATGGGGGAGG + Intergenic
982058616 4:151579311-151579333 GGGGATGTTGATAATCCGGGAGG + Intronic
982168357 4:152637061-152637083 GGGGACGTTGATAATGGGGGAGG + Intronic
982211938 4:153044828-153044850 GGGTATGTTGATAATGGGGGAGG + Intergenic
982429250 4:155303707-155303729 GGGGATGCTGATAACGGGGGAGG + Intergenic
982491243 4:156032129-156032151 GAGGATGTTGATAATGGAGGAGG - Intergenic
983110702 4:163745947-163745969 GGGGGTGTTGATAATGGGGGAGG - Intronic
983376032 4:166929066-166929088 GAGTATGTTGATAATGGGGAGGG + Intronic
983811355 4:172066028-172066050 GGGGATGTTGGTAATGAGGGAGG - Intronic
984292630 4:177814564-177814586 GGGGATGTTGATAATAGGGGAGG - Intronic
984313617 4:178097368-178097390 GGGGATGTTGATAATGGGGAAGG + Intergenic
984337318 4:178409145-178409167 GGGGATGTTGATAATAGAGGAGG + Intergenic
985269750 4:188182825-188182847 GGGGATGGTAGTAGTGGGGTAGG + Intergenic
985308087 4:188565740-188565762 GGGGCTTTTGATAATGGGGGAGG - Intergenic
986021824 5:3811819-3811841 GGGGATGCTCATAATGGGGGAGG + Intergenic
986373944 5:7110970-7110992 GGGGATGTTGATAATGGGAGAGG + Intergenic
986839000 5:11674451-11674473 GGGGATGTTGATAATGAGGGAGG - Intronic
986877426 5:12128355-12128377 GGGGATGTTGATAATGAGGGAGG + Intergenic
987024085 5:13906317-13906339 GGGGATGTTCATAATGGGGGAGG + Intronic
987420740 5:17717297-17717319 GGGGATGTTGTTAATGGGGGAGG + Intergenic
987790120 5:22554369-22554391 GGAGATGTTGATAATGAGGGAGG + Intronic
988007558 5:25436712-25436734 GGGGATGTTGATAATAAGGGAGG + Intergenic
988372936 5:30395909-30395931 GGGGATGTTGATAATGGTAGAGG - Intergenic
989100735 5:37820643-37820665 GGGGATGTTGACAATGGAGGAGG + Intronic
989395797 5:40955026-40955048 GGAGATGTTGATAGTGGGGAAGG - Intronic
989809003 5:45649350-45649372 GGGGATGTTGATAATGGGGAGGG - Intronic
989843921 5:46115653-46115675 GGGGATGTTGATAGTGGGGAAGG - Intergenic
990301461 5:54453056-54453078 GGTGGTGTTGATAATGGGGGAGG + Intergenic
990372516 5:55135102-55135124 GGAGATGTTGATAACGGGGGAGG + Intronic
990445452 5:55889773-55889795 GGGGATGTTCATATCTGTGTAGG + Intronic
990722810 5:58717024-58717046 GGGGATGTTGATAGTGGAGGAGG + Intronic
991008200 5:61853062-61853084 GGGTATGTTGATAATGGGGAAGG + Intergenic
991574696 5:68090701-68090723 GGGGGTGTTGATACTGGGGGAGG - Intergenic
991688307 5:69201981-69202003 GGGGATGTTGATAATGGGAGAGG + Intronic
992095038 5:73355021-73355043 GGGGATGTTGATTATGGAGGAGG + Intergenic
992134646 5:73731966-73731988 GGGGATGTGGATACTGGGGGAGG - Intronic
992852776 5:80827993-80828015 GGGGATGCTGAAAATGGGGGAGG - Intronic
993256767 5:85601502-85601524 GGGGATGTTGATGATAGGGGAGG + Intergenic
994802329 5:104394859-104394881 AGGGATGTTCATAATTGTGGAGG + Intergenic
995158243 5:108941983-108942005 GGAGATGTTGATAATGGTGGAGG + Intronic
995469688 5:112488014-112488036 AGGGATGTTGGTAATGGGGGAGG - Intergenic
995577000 5:113547553-113547575 GGGGATGTTGATAATGGGGGAGG + Intronic
996002434 5:118380827-118380849 AGGGATGTTGATAATGGGGTGGG - Intergenic
996026707 5:118654521-118654543 GGGGAGGCTTATAATGGGGGAGG - Intergenic
996070761 5:119128664-119128686 GTGGATGTTGATAATGTGGGAGG + Intronic
996182322 5:120434233-120434255 GGGAATGGTTATAATGGGGAAGG + Intergenic
996580063 5:125021824-125021846 GAGGATATTGATAATGGGGGAGG + Intergenic
996987651 5:129586105-129586127 GTGAATGTTGATAATGGGGGAGG - Intronic
997054952 5:130431110-130431132 GGGGATGTTGATAATGGAGGAGG + Intergenic
997058353 5:130471232-130471254 GGGGATATTAATAATGGAGAAGG - Intergenic
998311119 5:141133355-141133377 GAGGATGTTGATAATGGGTGAGG + Intronic
998361889 5:141595377-141595399 GGGGATGTTGACAATGGGGGAGG + Intronic
998602465 5:143599178-143599200 GGGGGTGTTGATAATGGAGGAGG - Intergenic
999189554 5:149736859-149736881 GGGAATATTAATAATGGGGGAGG - Intronic
999409331 5:151336697-151336719 GGGGGTGTTCATAATGTGTGGGG - Intronic
999418914 5:151423848-151423870 GTGGATGTTGATAATGGGAGAGG + Intergenic
999427866 5:151503287-151503309 GGGAATGTTAATAATGAGGGAGG + Intergenic
999846146 5:155482683-155482705 GTGGATGTAGATAATGGGGGAGG + Intergenic
1000405393 5:160882317-160882339 GGGGATGTTGATAATGGGAGAGG + Intergenic
1001207594 5:169779002-169779024 AGGGATGTTGATAGTGGGGAAGG + Intronic
1001873954 5:175183049-175183071 AGGGATGTGCATATTGGGATGGG + Intergenic
1001923777 5:175621281-175621303 GGTGATGTTGATAATGGTGATGG + Intergenic
1002054583 5:176591406-176591428 GGGGAGGTTCAGCATGGGGTTGG - Exonic
1002084511 5:176764215-176764237 GGGGACGTTGATAATGGGGGAGG - Intergenic
1002319816 5:178368377-178368399 GGGGATGCTGATCATGGGGGAGG - Intronic
1003522096 6:6867034-6867056 GGGGATGTGGATTATGGGGAAGG - Intergenic
1003854513 6:10259363-10259385 GGGGATGTTGATTGTGGGGGAGG + Intergenic
1004471475 6:15933355-15933377 GGGGATGTTAATAATAGGGGAGG - Intergenic
1004588054 6:17021954-17021976 GGGGGTGTTGATAATAGGGGAGG - Intergenic
1004794098 6:19061909-19061931 GTGGATATTGATAATGGGGGAGG - Intergenic
1005688453 6:28278700-28278722 GGGGATGTTGATAATAGGGGAGG - Intronic
1006237295 6:32645207-32645229 GGAGATGTTGCTAATGGGGGAGG + Intronic
1006590637 6:35153291-35153313 GGGGATATTGATAATGGGGGAGG - Intergenic
1007624339 6:43234795-43234817 AGGGATGTTGATAATGGCGGAGG + Intergenic
1008358088 6:50579260-50579282 GGGGATATTAATAATGGGGGAGG + Intergenic
1008744255 6:54649714-54649736 GGGAATGTTCATAATGGGAGAGG - Intergenic
1010770823 6:79827985-79828007 GGGAATGTTGATAACGGGGGAGG + Intergenic
1010801631 6:80183530-80183552 GGGGATGTTGGCAATGGGGAAGG - Intronic
1011500114 6:87978959-87978981 GGGGATGTTGATAATGGAAGAGG - Intergenic
1011658292 6:89571701-89571723 GCGGATGTTGATAATGGGATAGG - Intronic
1012163472 6:95918215-95918237 GGGGATGTTGATAATGAGGGAGG + Intergenic
1012320906 6:97844390-97844412 AGGGATGTTGATAATGGGGAAGG - Intergenic
1012385590 6:98678342-98678364 GGGGATGTTGATAATTGGAGAGG + Intergenic
1013517748 6:110904067-110904089 GGGGATGTTGATAATGAAGGAGG - Intergenic
1013566602 6:111370799-111370821 GGGGATGGTGATAATGAGGGAGG - Intronic
1013720726 6:113024966-113024988 GGGGATGTTGATAATAGGGATGG + Intergenic
1013845629 6:114447593-114447615 AGGAATGTTGATAATGGGGGAGG - Intergenic
1014333798 6:120105669-120105691 GAGGATGTTGATAATGGGGGAGG - Intergenic
1014701042 6:124688410-124688432 GAGGATGCTGATAATGGGGGAGG - Intronic
1014716442 6:124869826-124869848 GAGGATGTTGATAGTGGGGAAGG + Intergenic
1014775276 6:125501929-125501951 GGGGATGTTGATAATGAGGGCGG + Intergenic
1015054161 6:128879136-128879158 GGGCATGTTGATAAAGGGGGAGG + Intergenic
1015689909 6:135910519-135910541 GGGGATGTGGATAATGGAGGAGG - Intronic
1015757182 6:136619523-136619545 GGGAATGTTGATAAGGGGGGAGG - Intronic
1015767450 6:136733727-136733749 GGGGATGTTGACAATGGGGGAGG - Intronic
1016050798 6:139528056-139528078 GGGAATGTTGATAATGGGTGAGG + Intergenic
1016125578 6:140398806-140398828 GGGGATATTGATAATGGAGGAGG - Intergenic
1016145095 6:140660844-140660866 GGGAATGTTGACAATGGGGGAGG + Intergenic
1016430297 6:143977105-143977127 GGGGATGTCGATAATGGAGAAGG - Intronic
1016678462 6:146799688-146799710 GGGGATGTTAATAATGGGGGAGG + Intronic
1017768513 6:157626600-157626622 GGAGATGTTGATAATGGGGGAGG - Intronic
1018289617 6:162278500-162278522 GGGGATGTTGATAATGGAGAGGG + Intronic
1018657418 6:166051688-166051710 GGGGATGTTGATAAGGGAGGAGG - Intergenic
1020770368 7:12384558-12384580 GGGGACGTCGACAATGGGGTTGG + Intronic
1020866327 7:13568662-13568684 GGGGATGTTGATAATGAGGGAGG - Intergenic
1020874980 7:13681818-13681840 GGGGATGTTGATAATGGGGGAGG + Intergenic
1021086375 7:16424913-16424935 GGAGATGTTAATAATGTGGGAGG - Intergenic
1021341040 7:19463067-19463089 GGGGATGTTGATAATGGGGGAGG + Intergenic
1021604884 7:22399990-22400012 GGGTAAGTTCACATTGGGGTGGG - Intergenic
1024035958 7:45507627-45507649 GGGGATGTTGATAATGGGGGAGG - Intergenic
1024144288 7:46496441-46496463 GGGGATGTTGATAATGAGGGAGG + Intergenic
1024721553 7:52142457-52142479 GGGGATGTTGATAAGGGAGGGGG + Intergenic
1024899661 7:54304286-54304308 GGGGATGTTGATAATGGCATAGG + Intergenic
1024923171 7:54582506-54582528 GGGGATGTTAATAGTGTGGGAGG + Intergenic
1026167668 7:67924587-67924609 GGGGATGTTAATAGTGGGAGAGG + Intergenic
1027393651 7:77730332-77730354 GGGGATGTTAATAATGGGGAAGG - Intronic
1027982834 7:85249040-85249062 GGGGATGTTGACAATGGGAGAGG + Intergenic
1028723003 7:94055449-94055471 GGGGATGTTGATAATGGTGGAGG + Intergenic
1028770188 7:94610418-94610440 GGGGATGTTGATAATGGGGGAGG + Intronic
1029000637 7:97151071-97151093 GGGGATGCTGATAATGGGAGAGG - Intronic
1029846108 7:103413895-103413917 GGGGATGTTGATAGTGGGGGAGG - Intronic
1029920930 7:104262539-104262561 TGGGATGTTGATAGTGGGGGAGG - Intergenic
1030062128 7:105630771-105630793 GGGGATGTTGATAGTGGCGGAGG + Intronic
1030180034 7:106697240-106697262 GGGGATATTGATAGTGGGGGAGG - Intergenic
1030290528 7:107867676-107867698 GGGGATGTTGATAATGGGAGAGG + Intergenic
1030578997 7:111328666-111328688 TGGGATGTTCATAATGCTGAAGG + Intronic
1031081539 7:117263030-117263052 GGGGATAGTTATAATGGTGTTGG - Intergenic
1031261001 7:119520387-119520409 GGAGATGTTGATAATAGGGGAGG + Intergenic
1031379005 7:121061518-121061540 GGGGATGTTAATAATGGAGGAGG + Intronic
1031430239 7:121659038-121659060 GAGGATGTTGATAATTGGGATGG - Intergenic
1031542396 7:123010208-123010230 CAGGATGTTGATAATGGGGAAGG + Intergenic
1031824503 7:126546409-126546431 TGGGATGTTCCTAATAGAGTTGG - Intronic
1032757307 7:134903355-134903377 AGGGATGTTTATAATGGGAGAGG + Intronic
1033402708 7:141042071-141042093 GGGGGTGTTAATAATGGGGGAGG + Intergenic
1033435198 7:141327409-141327431 GGGAATGTTGATAGTGGGGGAGG - Intronic
1034025867 7:147703148-147703170 GGGGAGGTTGGTAATGTGGTTGG - Intronic
1034146995 7:148883292-148883314 GGGGATGTACACAATGAAGTGGG + Intronic
1035525823 8:312411-312433 GGGGATGTTGATAATGGGGGAGG - Intergenic
1035836151 8:2754376-2754398 GGGGATGTTCATAACTGGGGAGG + Intergenic
1036064819 8:5368096-5368118 GAAGATGTTGATAATGGGGTAGG + Intergenic
1036464002 8:8979244-8979266 GGGGATGTTGACAAAGGTGTGGG - Intergenic
1036703223 8:11027888-11027910 TGGGATGTTGATAATGGGGGAGG - Intronic
1037120332 8:15277480-15277502 GAGGATGTTGATAATAGGGAAGG + Intergenic
1037687526 8:21155877-21155899 GGGGATGTTGATAGTGTGGAAGG + Intergenic
1038044471 8:23754455-23754477 GGGGATGTCCACAGTGGGGGAGG - Intergenic
1038473879 8:27848224-27848246 GGGGATGTTGATAATGGGGAAGG - Intergenic
1038477955 8:27881801-27881823 GGGGATGTTGATAATGGGGGAGG - Intronic
1039333363 8:36563230-36563252 AGGGATGTTGATAATGGGGGAGG + Intergenic
1039782857 8:40804296-40804318 GGTGATGTTGATAATAGGGGAGG + Intronic
1039940956 8:42090700-42090722 GGGGATGTTTATAATGGGGGAGG + Intergenic
1040004847 8:42611227-42611249 TGGGATGTTGATAATGGGGAAGG + Intergenic
1040598557 8:48862960-48862982 GGGGATGTTCCTAAGGAGGCAGG - Intergenic
1040793526 8:51263258-51263280 GGTGATATTGATAATGGGGGAGG - Intergenic
1041093288 8:54324929-54324951 GGGGGTGTTGATAATGGGGGAGG + Intergenic
1041403454 8:57469527-57469549 GGGTATGTTCCTAATCGGGAAGG - Intergenic
1042127356 8:65551876-65551898 GAGGATGTTGATAGTGGGGGAGG - Intergenic
1042243999 8:66692818-66692840 GCAGATGTTGATAATGGGGGAGG + Intronic
1042422291 8:68605929-68605951 GGGGATGTTGATAATGGCAGAGG + Intronic
1042427800 8:68669232-68669254 GGGGATGTTGATAATGGGGGAGG + Intronic
1043038801 8:75232549-75232571 GAAGATGTTGATAATGGGGGGGG + Intergenic
1043532164 8:81163084-81163106 GGGAATGTTGATCATGGGGGAGG - Intergenic
1043562456 8:81509983-81510005 GGGGATGTTGGTAATGGGAGAGG + Intergenic
1043739710 8:83795363-83795385 GGGCATGTTGATAATGGGGGAGG + Intergenic
1043830880 8:84987422-84987444 GAGGATGTTGATAATGGGGGAGG - Intergenic
1043987688 8:86713950-86713972 GGGGATGTTGATAATGGGGAAGG - Intronic
1044057789 8:87593867-87593889 GGGGATGTTTATAATGGGAGAGG - Intronic
1044325302 8:90851708-90851730 GGGGATGTTAATAATGGGGCAGG - Intronic
1044833255 8:96270528-96270550 GGGGCTGTTCTAAATGAGGTGGG + Intronic
1044848107 8:96401460-96401482 GAGGATGTTGACAATGGGGGAGG + Intergenic
1044956887 8:97490437-97490459 GGGGACGTCGATAATGGGGGAGG + Intergenic
1045562990 8:103283715-103283737 GGGGATGCTCATAGTCGGGGAGG - Intergenic
1045650262 8:104335746-104335768 GGGGATGTTGATATTGGGGGAGG + Intronic
1045885572 8:107093831-107093853 GGGGATTTTAATAACGGGGGAGG - Intergenic
1046120083 8:109835307-109835329 AGGGATGTTGATAATGGAGAAGG - Intergenic
1046410950 8:113842506-113842528 GGGCATGTATATAATGGGGCAGG - Intergenic
1046426275 8:114054253-114054275 GGAGATGTTGATAATGAGGGAGG + Intergenic
1046869956 8:119195110-119195132 GGGAATGTTGATAATGGAGTTGG + Intronic
1046870078 8:119196538-119196560 GGGAATGTTGATAATGAAGTTGG + Intronic
1047190801 8:122677567-122677589 GGTGAAGTTGATAATGGGGGAGG + Intergenic
1047640650 8:126817978-126818000 GGGGATGTTGATAATGGGGGAGG - Intergenic
1047672764 8:127166407-127166429 GGGGATATTGAGAATGGGGGAGG - Intergenic
1047755333 8:127913818-127913840 GGGCATGATTAAAATGGGGTGGG - Intergenic
1048318644 8:133381166-133381188 GGGGATGTTGATAATGGGGGAGG + Intergenic
1048414350 8:134209741-134209763 TGGGATGTTGATAGTGGGGCAGG - Intergenic
1048810722 8:138283657-138283679 GGAGATGTTGATAATGGGGGAGG + Intronic
1049242217 8:141543806-141543828 GGGAAGGTTCAGAATGGGATGGG - Intergenic
1050145629 9:2564378-2564400 AGGGATGTTGATAATGGGTGAGG + Intergenic
1050196768 9:3093093-3093115 GGGGATGTTGATAATGGGTGAGG + Intergenic
1050619517 9:7438051-7438073 GGGGATGTTTTTAATAGGCTTGG + Intergenic
1050777353 9:9282286-9282308 GGGGATGTTGATAATGGGGCAGG + Intronic
1050804517 9:9656826-9656848 GGGGATGTTGATAGTGGGAAAGG + Intronic
1050847241 9:10237141-10237163 GGGGATGTTGATAATGGGTGAGG + Intronic
1050998296 9:12247426-12247448 GGGGATGTTGATAATAGTGAAGG - Intergenic
1051442178 9:17097087-17097109 TGGGATGTTGATAGTGGGGGAGG - Intergenic
1051746710 9:20301676-20301698 GGGGATGTTGATAATGGAGGAGG - Intergenic
1052139486 9:24961409-24961431 GAGGATGTTGATAACGGGGGAGG + Intergenic
1052783876 9:32810836-32810858 GGGGATGTTGATAGTGGGAGAGG + Intergenic
1053624760 9:39857820-39857842 GGGGATGTTTATTATGGGGGAGG - Intergenic
1053838118 9:42162779-42162801 GGGGATGTTTATTATGGGGGAGG - Intergenic
1053880110 9:42585408-42585430 GGGGATGTTTATTATGGGGGAGG + Intergenic
1053892551 9:42708901-42708923 GGGGATGTTTATTATGGGGGAGG - Intergenic
1054219135 9:62392878-62392900 GGGGATGTTTATTATGGGGGAGG + Intergenic
1054231578 9:62516295-62516317 GGGGATGTTTATTATGGGGGAGG - Intergenic
1055092244 9:72374784-72374806 TGGGATGTTGATAATGGGGAAGG + Intergenic
1055527018 9:77145198-77145220 GGGGATGTTGATAGTGGGGAAGG + Intergenic
1055542036 9:77319821-77319843 GGGAATGTTAATAAAGGGGGAGG - Intronic
1055781512 9:79826278-79826300 GAGGATGCTCATAATGGGGGAGG + Intergenic
1055931997 9:81568628-81568650 TGGGATGTTGATAGTGGGGAAGG - Intergenic
1056084345 9:83130347-83130369 TGGGATGTTGATAATTGGGGAGG - Intergenic
1056096927 9:83264520-83264542 TGGGATGTTGATGATGGGGGAGG + Intronic
1056212443 9:84377238-84377260 GGGGATGTTGATAATGAGGGAGG - Intergenic
1056466591 9:86861808-86861830 GGGGATGTGGATAATAGGGGAGG + Intergenic
1056626644 9:88259119-88259141 GGGGATGTTGACAATGGGAGAGG - Intergenic
1056701467 9:88914634-88914656 TGGGATGTTGATAGTGGGGGAGG + Intergenic
1056844885 9:90029095-90029117 GGAGATGTTGATAATGGGGAAGG + Intergenic
1056921935 9:90798884-90798906 GGGGCTGTTGATAATGGGAAAGG - Intergenic
1057011108 9:91602115-91602137 GGGGATGTTAATAATGTGGGAGG - Intronic
1057309981 9:93936269-93936291 GGGGATGCTGATTATGGGGAAGG + Intergenic
1057531511 9:95851149-95851171 GGGGATGTTGATAGTGGCGGAGG + Intergenic
1057858687 9:98623009-98623031 GGGGATGTTGATAATGGGGGAGG + Intronic
1058863801 9:109143377-109143399 CAGGATGTTGATAATGGGGGAGG + Intronic
1059326312 9:113506068-113506090 GGGAAGGTTCTCAATGGGGTAGG + Intronic
1059582005 9:115559899-115559921 GGGGATGTTGATAATTGAGGAGG + Intergenic
1059685225 9:116628788-116628810 GGAGATGTTAATAGTGGGGGAGG + Intronic
1059894827 9:118850976-118850998 GGGGATGGTAATAATGGTGGAGG + Intergenic
1060111069 9:120906586-120906608 GGGGATGTTGATAGTGGGGGAGG - Intronic
1061216810 9:129226327-129226349 GGGGATTTGCAAGATGGGGTTGG + Intergenic
1062732552 9:138118180-138118202 GGGGATTTTGAGACTGGGGTGGG + Intronic
1062732598 9:138118332-138118354 GGGGATTTTGAGACTGGGGTGGG + Intronic
1185819241 X:3185657-3185679 GGGGATGTTCATAGTGGGGGAGG + Intergenic
1185852362 X:3500986-3501008 GGGGATATTGATAATGGGGGAGG + Intergenic
1185957523 X:4507775-4507797 GGGGATGTTGATAATTGCGGAGG - Intergenic
1186135824 X:6519419-6519441 GGGGATGTTGAGAGTGGGGGAGG - Intergenic
1186167356 X:6840810-6840832 GGGGATGTTGGTAATGGGGATGG + Intergenic
1186248233 X:7637663-7637685 GAGGATGTTAATAATGGGGGAGG - Intergenic
1186347251 X:8706608-8706630 GGGGATGTTGGTAATGGGAGAGG + Intronic
1187157643 X:16736000-16736022 AGGGTTGTTCCTAATGGGCTAGG - Intronic
1187219368 X:17308692-17308714 GGAGATGGTGATAATGGGGGAGG - Intergenic
1187783287 X:22854258-22854280 AGGGATGTTGATAGTGGGGGAGG + Intergenic
1187911621 X:24116539-24116561 GGGGATGTTGATCATGTGGGAGG - Intergenic
1188269050 X:28116092-28116114 GGGGATGTTGATAATGGGGGAGG - Intergenic
1188329033 X:28845866-28845888 GGGGATGTTGATAATGAGAGAGG - Intronic
1188622165 X:32239456-32239478 TGGGATGTTGATAGCGGGGTAGG - Intronic
1188709123 X:33372513-33372535 GGGCGTGTTGATAATGGGGGAGG - Intergenic
1189001218 X:36949364-36949386 GGGGATGTTGAAAATGGAGTAGG - Intergenic
1189027559 X:37413074-37413096 AGGGATGTTGATAATGGGAAGGG - Intronic
1189464969 X:41271638-41271660 GGGGATATTGATAATGGGGGAGG + Intergenic
1189614674 X:42770796-42770818 GGAGATGTTTATGGTGGGGTTGG - Intergenic
1189937545 X:46085581-46085603 GGGGATGTTGATAGTGGGGGAGG - Intergenic
1192187645 X:68962863-68962885 GGGGATGTTGATAATGGGGGAGG - Intergenic
1192587323 X:72329291-72329313 GGGGCTGTCCATGGTGGGGTAGG - Intergenic
1192903643 X:75525670-75525692 GGGGATGTTGATAATGGAGGTGG - Intergenic
1192941863 X:75920979-75921001 GGGAATGTTCATTCTTGGGTGGG - Intergenic
1193821746 X:86173622-86173644 GAGAGTGTTCATAATGGAGTAGG + Intronic
1194184444 X:90756510-90756532 GGGGATATTGATAATGGGGGAGG + Intergenic
1194278762 X:91921247-91921269 GGGGATATTGACAATGGGGGAGG - Intronic
1195587481 X:106581812-106581834 GAGGATGTTGATAATGGGTGAGG + Intergenic
1195943462 X:110184117-110184139 CAGGATGTTGATAGTGGGGTAGG + Intergenic
1197241182 X:124124907-124124929 GGGGATGTTGATAATGGGAAGGG + Intronic
1198255587 X:134921649-134921671 GAGGCTGTTGATAATGGGGGAGG + Intergenic
1198502376 X:137264252-137264274 GAGGATGTTGATAATGGGGGAGG + Intergenic
1198564794 X:137893395-137893417 GGGGATATTGATGATGGGGGAGG + Intergenic
1198786479 X:140294237-140294259 GGGGATATTGATAATGTGGAAGG - Intergenic
1199088090 X:143652623-143652645 GAGGATGTTGATAAAGGGGAAGG - Intergenic
1199498839 X:148486676-148486698 GAGGATGTTGATAATGGGGAAGG + Intergenic
1200147650 X:153934893-153934915 GCGGATGTTCATAACGGCGGCGG + Exonic
1200531033 Y:4338423-4338445 GGGGATATTGATAATGGGGGAGG + Intergenic
1200596245 Y:5144749-5144771 GGGGATATTGACAATGGGGGAGG - Intronic
1201273920 Y:12281570-12281592 GGGGATGTGGATACTGGGGGAGG + Intergenic
1201745825 Y:17372321-17372343 GGAGATGTTGATAATGGGAGAGG - Intergenic