ID: 1110212297 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 13:72987944-72987966 |
Sequence | CACATAAACCCGGGGGGCGG AGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 47634 | |||
Summary | {0: 1, 1: 3, 2: 201, 3: 6427, 4: 41002} |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1110212297_1110212309 | 17 | Left | 1110212297 | 13:72987944-72987966 | CCTCCGCCCCCCGGGTTTATGTG | 0: 1 1: 3 2: 201 3: 6427 4: 41002 |
||
Right | 1110212309 | 13:72987984-72988006 | TCCCAAGTAACTGGGACTACAGG | 0: 1213 1: 46838 2: 161917 3: 225153 4: 236742 |
||||
1110212297_1110212305 | 8 | Left | 1110212297 | 13:72987944-72987966 | CCTCCGCCCCCCGGGTTTATGTG | 0: 1 1: 3 2: 201 3: 6427 4: 41002 |
||
Right | 1110212305 | 13:72987975-72987997 | GCCTCAGCCTCCCAAGTAACTGG | 0: 2348 1: 88449 2: 198708 3: 240149 4: 234925 |
||||
1110212297_1110212307 | 9 | Left | 1110212297 | 13:72987944-72987966 | CCTCCGCCCCCCGGGTTTATGTG | 0: 1 1: 3 2: 201 3: 6427 4: 41002 |
||
Right | 1110212307 | 13:72987976-72987998 | CCTCAGCCTCCCAAGTAACTGGG | 0: 2835 1: 101216 2: 211662 3: 252465 4: 268723 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1110212297 | Original CRISPR | CACATAAACCCGGGGGGCGG AGG (reversed) | Intronic | ||