ID: 1110212297

View in Genome Browser
Species Human (GRCh38)
Location 13:72987944-72987966
Sequence CACATAAACCCGGGGGGCGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 47634
Summary {0: 1, 1: 3, 2: 201, 3: 6427, 4: 41002}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110212297_1110212309 17 Left 1110212297 13:72987944-72987966 CCTCCGCCCCCCGGGTTTATGTG 0: 1
1: 3
2: 201
3: 6427
4: 41002
Right 1110212309 13:72987984-72988006 TCCCAAGTAACTGGGACTACAGG 0: 1213
1: 46838
2: 161917
3: 225153
4: 236742
1110212297_1110212307 9 Left 1110212297 13:72987944-72987966 CCTCCGCCCCCCGGGTTTATGTG 0: 1
1: 3
2: 201
3: 6427
4: 41002
Right 1110212307 13:72987976-72987998 CCTCAGCCTCCCAAGTAACTGGG 0: 2835
1: 101216
2: 211662
3: 252465
4: 268723
1110212297_1110212305 8 Left 1110212297 13:72987944-72987966 CCTCCGCCCCCCGGGTTTATGTG 0: 1
1: 3
2: 201
3: 6427
4: 41002
Right 1110212305 13:72987975-72987997 GCCTCAGCCTCCCAAGTAACTGG 0: 2348
1: 88449
2: 198708
3: 240149
4: 234925

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110212297 Original CRISPR CACATAAACCCGGGGGGCGG AGG (reversed) Intronic
Too many off-targets to display for this crispr