ID: 1110212307

View in Genome Browser
Species Human (GRCh38)
Location 13:72987976-72987998
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 836901
Summary {0: 2835, 1: 101216, 2: 211662, 3: 252465, 4: 268723}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110212298_1110212307 6 Left 1110212298 13:72987947-72987969 CCGCCCCCCGGGTTTATGTGATT 0: 1
1: 7
2: 422
3: 12693
4: 63989
Right 1110212307 13:72987976-72987998 CCTCAGCCTCCCAAGTAACTGGG 0: 2835
1: 101216
2: 211662
3: 252465
4: 268723
1110212300_1110212307 2 Left 1110212300 13:72987951-72987973 CCCCCGGGTTTATGTGATTCTCC 0: 1
1: 26
2: 567
3: 3232
4: 7111
Right 1110212307 13:72987976-72987998 CCTCAGCCTCCCAAGTAACTGGG 0: 2835
1: 101216
2: 211662
3: 252465
4: 268723
1110212299_1110212307 3 Left 1110212299 13:72987950-72987972 CCCCCCGGGTTTATGTGATTCTC 0: 1
1: 447
2: 18042
3: 94413
4: 187475
Right 1110212307 13:72987976-72987998 CCTCAGCCTCCCAAGTAACTGGG 0: 2835
1: 101216
2: 211662
3: 252465
4: 268723
1110212297_1110212307 9 Left 1110212297 13:72987944-72987966 CCTCCGCCCCCCGGGTTTATGTG 0: 1
1: 3
2: 201
3: 6427
4: 41002
Right 1110212307 13:72987976-72987998 CCTCAGCCTCCCAAGTAACTGGG 0: 2835
1: 101216
2: 211662
3: 252465
4: 268723
1110212301_1110212307 1 Left 1110212301 13:72987952-72987974 CCCCGGGTTTATGTGATTCTCCT 0: 1
1: 22
2: 395
3: 2208
4: 4930
Right 1110212307 13:72987976-72987998 CCTCAGCCTCCCAAGTAACTGGG 0: 2835
1: 101216
2: 211662
3: 252465
4: 268723
1110212303_1110212307 -1 Left 1110212303 13:72987954-72987976 CCGGGTTTATGTGATTCTCCTGC 0: 9
1: 1130
2: 38661
3: 98871
4: 146931
Right 1110212307 13:72987976-72987998 CCTCAGCCTCCCAAGTAACTGGG 0: 2835
1: 101216
2: 211662
3: 252465
4: 268723
1110212302_1110212307 0 Left 1110212302 13:72987953-72987975 CCCGGGTTTATGTGATTCTCCTG 0: 6
1: 1087
2: 39910
3: 122362
4: 208957
Right 1110212307 13:72987976-72987998 CCTCAGCCTCCCAAGTAACTGGG 0: 2835
1: 101216
2: 211662
3: 252465
4: 268723

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
Too many off-targets to display for this crispr