ID: 1110213702

View in Genome Browser
Species Human (GRCh38)
Location 13:73003202-73003224
Sequence ATGATTCCCTAGAAGAGCTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 114}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110213702 Original CRISPR ATGATTCCCTAGAAGAGCTT TGG Intronic
901557362 1:10042157-10042179 TTCTTTCCCTACAAGAGCTTGGG - Intronic
903451316 1:23455582-23455604 AGGGTTCCCTGGAGGAGCTTTGG - Intronic
904189248 1:28730923-28730945 ATTGTTCCTGAGAAGAGCTTTGG + Intergenic
906925423 1:50110702-50110724 ATTTTTCCCTAGAAAAGCCTGGG + Intronic
908434700 1:64093608-64093630 AGGGTTCCCTAGAAGTGCTTAGG - Intronic
908686287 1:66723533-66723555 CTAATTCCCTAGAAAAGCTTAGG + Intronic
908706287 1:66959442-66959464 ATGATTTCCTATAAAAACTTAGG - Intronic
908779424 1:67675989-67676011 ATGCTTCTCTAGAACAGCTGTGG - Intergenic
916965297 1:169934079-169934101 ATACTTCCCTAGAAATGCTTAGG + Intronic
917930251 1:179817864-179817886 CTGATTCCATAGAACAGCTGTGG - Intergenic
919648514 1:200121491-200121513 ATGATTCTTTAGGAAAGCTTTGG + Intronic
919771358 1:201161335-201161357 TTGTTTCCCTAAAAGAGCCTTGG + Intronic
920169365 1:204061075-204061097 TTCATTGCCTAGCAGAGCTTTGG + Intergenic
922912745 1:229231323-229231345 CTGTTTTTCTAGAAGAGCTTAGG - Intergenic
924098752 1:240582131-240582153 ATAATTCATTAGAAGAGTTTAGG + Intronic
924112136 1:240710747-240710769 ATAATGGCATAGAAGAGCTTTGG - Intergenic
1062763434 10:44819-44841 CTGAAGCTCTAGAAGAGCTTGGG - Intergenic
1066330349 10:34414906-34414928 ATGAGTCCCTGGAAGAGTTATGG - Intronic
1066523476 10:36249178-36249200 ATGCTTCCCTGGAAGATCTAAGG + Intergenic
1068855086 10:61789350-61789372 TTGCTTCCCTAGAAGATCGTTGG - Intergenic
1069678629 10:70267624-70267646 ATGACTTCCCAGAAGAGCTGTGG - Intronic
1071162229 10:82761438-82761460 AGGATTCTTTAGAAGAGTTTTGG - Intronic
1074980314 10:118614349-118614371 ATGATGCCATAGAACAGCTTAGG - Intergenic
1077695482 11:4389146-4389168 ATGATTTCCTAGGAGAGGTGGGG - Intronic
1081087521 11:38820723-38820745 TTGATTGCCTAGAAGAGTTTTGG + Intergenic
1082642024 11:55673915-55673937 ATGATTCCAAAGAAGTGCATGGG - Intergenic
1086547036 11:88009617-88009639 ATGATTCTGTTGAAGTGCTTGGG + Intergenic
1092663429 12:10765471-10765493 ATGATTTCCTAGAACACTTTTGG + Intergenic
1092829955 12:12434010-12434032 AGGGTTCCCAAGATGAGCTTTGG + Intronic
1094768444 12:33624567-33624589 AGGATTCCATGGAAGTGCTTCGG - Intergenic
1096667929 12:53179412-53179434 ATGATTCCCTTCAGGAGCATGGG + Intronic
1104283264 12:127397796-127397818 ATCATTTCCTGGAAGGGCTTGGG - Intergenic
1105512618 13:21062827-21062849 AAGATTCCCTGGAAGAGCTGAGG - Intergenic
1106056189 13:26239607-26239629 ATTCTTCCCTGGAAGAGTTTTGG - Intergenic
1108490800 13:50979178-50979200 ATGATTTCAAAGAAGAGATTGGG - Intergenic
1109388104 13:61658839-61658861 ATGATGCCCAAAAGGAGCTTTGG + Intergenic
1110112117 13:71760807-71760829 ATGATCCCCATGAAGAGATTGGG - Intronic
1110213702 13:73003202-73003224 ATGATTCCCTAGAAGAGCTTTGG + Intronic
1112158713 13:96846741-96846763 ATCATTGCCTAGTAGAACTTGGG - Intergenic
1113776107 13:112946016-112946038 ATGATACCCCAGAAGAGCCCGGG - Intronic
1115514124 14:34168215-34168237 ATGATTCTGCTGAAGAGCTTGGG - Intronic
1119145399 14:72309155-72309177 AGGCTTCCCTAGAACAGCTCCGG - Intronic
1119507624 14:75186466-75186488 ATCAATCACTAGAAGAACTTTGG - Intergenic
1119849940 14:77860095-77860117 AAGACTTCCTAGAAGAGCTGGGG - Intronic
1122652859 14:103235371-103235393 ATGATGCCATAGAACAGCTTAGG + Intergenic
1126558145 15:50013301-50013323 ATGTCCCCCTAGAAGAGCTATGG - Intronic
1128183085 15:65621960-65621982 AGGATTCCATAGGAGAGCTGGGG + Exonic
1128187321 15:65653615-65653637 ATTAATAACTAGAAGAGCTTAGG - Intronic
1129682662 15:77666577-77666599 ATGGCTCAGTAGAAGAGCTTGGG + Intronic
1133635791 16:7663928-7663950 ATGATTCCCCAGAAGCTTTTTGG - Intronic
1147135208 17:38430087-38430109 ATGGTTCCCAAGAAGAGGTCAGG - Intronic
1148502542 17:48102512-48102534 CTGATTCCCTAGAGTAGGTTAGG + Intergenic
1149683473 17:58521343-58521365 ATGCTTTCCTGGAAGAGGTTAGG + Exonic
1152956343 18:45150-45172 CTGAAGCTCTAGAAGAGCTTGGG - Intergenic
1156602861 18:38630826-38630848 GTGATTCCCTAGAATTGCTAGGG + Intergenic
1156864671 18:41875513-41875535 ATGATTCCTAAGAAAAGCATAGG + Intergenic
1157287547 18:46387331-46387353 ATGATTCCAGTGCAGAGCTTGGG + Intronic
1157731081 18:50005031-50005053 GTGACTACTTAGAAGAGCTTGGG - Intronic
1158687385 18:59626863-59626885 TTGATTCCACAGCAGAGCTTGGG + Intronic
1160059424 18:75515849-75515871 ATGAATCCCTGGAAGAGCCTTGG + Intergenic
1164425055 19:28133764-28133786 CTGATTCCCCATGAGAGCTTGGG - Intergenic
928621391 2:33091812-33091834 AAGTTTCCCTGGAAGAGCTCAGG - Intronic
932126912 2:69152888-69152910 ATGTCTCCCCAGAATAGCTTAGG + Intronic
933818439 2:86088061-86088083 ATTTTTCCCAAGCAGAGCTTGGG + Intronic
936628140 2:114170660-114170682 ATGATTTCCCAGAACAGCTCTGG + Intergenic
939445849 2:142309720-142309742 ATCATTCACTAGAACAGCATGGG + Intergenic
943741550 2:191415627-191415649 ATGATTCCCTTGCACAGCTAAGG + Intronic
945112856 2:206379529-206379551 GTGATTGCCTAGAACAGCTGTGG + Intergenic
947858226 2:233338871-233338893 AGGATTACCAAGTAGAGCTTGGG + Intronic
1169412681 20:5385742-5385764 ATGAATCACAAGAAGAACTTTGG + Intergenic
1171093258 20:22306214-22306236 TTAATTCCCTAGCAGAGCTCTGG - Intergenic
1171229142 20:23468426-23468448 AAGATGCCATAGAACAGCTTAGG + Intergenic
1173628525 20:44491921-44491943 ATAATTCTCTAGGAGAGCTGTGG - Exonic
1175354974 20:58357993-58358015 TCTCTTCCCTAGAAGAGCTTAGG + Intronic
1178776069 21:35551900-35551922 AACATTGCATAGAAGAGCTTGGG + Intronic
1185383779 22:50522386-50522408 AGGATTCCCTGGAAGACCTGGGG + Exonic
954004936 3:47583205-47583227 AGGATGCCCGAGAAGTGCTTAGG - Intergenic
954561353 3:51559287-51559309 AAGATTCCTTATAAGAGGTTAGG - Intronic
961025611 3:123553453-123553475 AAGATTCCCAAGAAGGGCTGTGG - Intronic
965659565 3:171027196-171027218 ATGGTTACCTGGATGAGCTTTGG + Intergenic
965821514 3:172689129-172689151 CTTATTACCTAGAAGAACTTTGG - Intronic
969881418 4:10177304-10177326 ATGATTACATAGAAGAGATCTGG - Intergenic
974077526 4:57181117-57181139 ATGATTTTGTAGAAGGGCTTGGG - Intergenic
977650527 4:99463651-99463673 AAGATTCCCTAAAGGAGCTCAGG + Intergenic
979553148 4:122013925-122013947 ATGATGCCCTATAAGAACTTTGG - Intergenic
979879367 4:125935500-125935522 ATGTTTGCTTAGAATAGCTTTGG - Intergenic
980157005 4:129119286-129119308 ATAATACTCTAGAAGAGATTAGG - Intergenic
982567158 4:156999477-156999499 ATTATTTCCTAGAAGAGTCTAGG - Intergenic
990047407 5:51450404-51450426 ATGAATCCAGAGAAGACCTTTGG + Intergenic
992970906 5:82056725-82056747 ATGGTTCCTTAGAGGAGCATTGG - Intronic
993330646 5:86595960-86595982 ATCATTGCCTAGAAGAACTATGG - Intergenic
995319621 5:110818715-110818737 ATAAGTCCCTAGAAGAGGATAGG - Intergenic
998143499 5:139712492-139712514 AAGTTTCCCCAGAAGGGCTTGGG + Intergenic
999619372 5:153456864-153456886 CTGATTCACTAGAATTGCTTAGG + Intergenic
1000853582 5:166370886-166370908 ATGATTCTCTGGAAGAGTTGAGG + Intergenic
1004930509 6:20458779-20458801 ATGCTTCCCTAGAAGTCTTTGGG + Intronic
1010690140 6:78901288-78901310 ATTTTTCTATAGAAGAGCTTAGG + Exonic
1011217132 6:85016910-85016932 ATGCTTCCCTGGAAGAGCAGGGG - Intergenic
1013956408 6:115846536-115846558 ATTATTCCATATAAGAGCATAGG + Intergenic
1014524957 6:122491384-122491406 ATGATTCCCAAAAAGATCTCAGG - Intronic
1016285211 6:142464764-142464786 AAGATACCCTAGAAGAGCAGAGG + Intergenic
1022380077 7:29851399-29851421 ATGATTCCATTGAAAAGATTCGG - Intronic
1023854292 7:44172396-44172418 ATTAATCCATAGAAGAGCTTAGG - Intronic
1036507331 8:9367502-9367524 AATACTCCCCAGAAGAGCTTCGG + Intergenic
1036925133 8:12897477-12897499 ATGATTCTCTATAATAGATTGGG + Intergenic
1046350837 8:113009189-113009211 ATCATTCCCGTGGAGAGCTTTGG - Intronic
1046829798 8:118731889-118731911 ATGATTACACAGAAGTGCTTTGG + Intergenic
1048598830 8:135896806-135896828 ATGATTCCCTCTCAGAGCTGTGG - Intergenic
1049041766 8:140117535-140117557 ATGCTTTCATAAAAGAGCTTTGG - Intronic
1050622698 9:7471291-7471313 ATGATTGCAGAGAAGTGCTTGGG + Intergenic
1051535936 9:18157787-18157809 ATGATCCCCAAGAAGATCGTGGG - Intergenic
1053092243 9:35289355-35289377 AAGATTCCTTAGCAGACCTTGGG + Intronic
1055257181 9:74385386-74385408 TTAATTCCCTAGAAGAGATTTGG - Intergenic
1055857603 9:80709425-80709447 AAGCTCCCTTAGAAGAGCTTTGG - Intergenic
1058503144 9:105642908-105642930 TAGAGTCCTTAGAAGAGCTTAGG + Intergenic
1060754314 9:126201351-126201373 ATGACCCACTAGAAGAGCTAAGG + Intergenic
1062741860 9:138179629-138179651 CTGAAGCTCTAGAAGAGCTTGGG + Intergenic
1186080038 X:5921191-5921213 ATGATTCCAAAGAACAGCATAGG + Intronic
1187972787 X:24675177-24675199 ATGATTCCCCAAAAGAGACTGGG + Intergenic
1188505538 X:30879257-30879279 TTGATTCTCTGGAAGAGTTTAGG - Intronic
1191989253 X:67015636-67015658 ATGAATAACAAGAAGAGCTTTGG + Intergenic
1193670642 X:84381385-84381407 ATTTTTGCCTAGAATAGCTTTGG - Intronic
1194871825 X:99141833-99141855 ATAATTCCTTAAAAGAGATTGGG - Intergenic
1198603352 X:138309080-138309102 ATGTTTCCATAAGAGAGCTTTGG - Intergenic
1199501295 X:148509499-148509521 AAGTCTCCCAAGAAGAGCTTTGG + Intronic