ID: 1110219409

View in Genome Browser
Species Human (GRCh38)
Location 13:73058252-73058274
Sequence CCCTCCTCCCCACACACGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 407
Summary {0: 1, 1: 0, 2: 1, 3: 31, 4: 374}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110219409 Original CRISPR CCCTCCTCCCCACACACGGA TGG Intronic
900360725 1:2287697-2287719 CCCCACGCCCCACACAGGGAAGG - Intronic
900413334 1:2523678-2523700 GCCTACTCCCCACACCCGGGGGG + Intronic
900640293 1:3685170-3685192 TCCTCCTCCCGACACAGGGTGGG - Intronic
903081482 1:20815859-20815881 CCCCCCTCCCCCCTCCCGGACGG - Intronic
903122452 1:21225220-21225242 CCCCGCTCCCCACACGCGCACGG - Intronic
903332088 1:22601499-22601521 CCCCCCTGCCCCCACACGCATGG - Intronic
903637720 1:24833440-24833462 CCCCCCTCCCCCCTCCCGGACGG + Intronic
904035342 1:27555946-27555968 CCCTCCTCACCACACCCCGGCGG + Intronic
904410354 1:30321388-30321410 CCTTCCTTCCCACACTCGGGCGG - Intergenic
904466605 1:30711785-30711807 CTCTCCTCCCCACACAGGTGGGG - Exonic
904784663 1:32974800-32974822 CCCCCCTCCCCCCTCCCGGACGG + Intergenic
905015683 1:34777019-34777041 CCCACCTCTCCACTCAAGGAAGG + Intronic
905557353 1:38897712-38897734 CCCTCACCCCCACACACAAAAGG + Intronic
905629198 1:39509588-39509610 TCCTCCTGCCCACACACGTCTGG + Intronic
905632054 1:39524452-39524474 CCAGCCTCTCCACACAAGGAGGG + Intronic
905668557 1:39776595-39776617 TCCTCCTGCCCACACACGTCTGG - Intronic
905755839 1:40508631-40508653 CCCTCCTCCGCTCACAGAGACGG + Intergenic
906123411 1:43410951-43410973 CCCTGCTCCCCACCCAGGCAGGG - Intronic
906190884 1:43898889-43898911 CCCTCCTCACCACCCACGCCTGG + Intronic
906262694 1:44406116-44406138 GCCTCCACCCCACACACAGCCGG + Intronic
906427342 1:45725097-45725119 CCCCCCTCCCCCCTCCCGGACGG - Intronic
906427367 1:45725146-45725168 CCCCCCACCCCACTCCCGGACGG - Intronic
906718045 1:47984830-47984852 CCCTCCTCCCAACACCTGCACGG + Intronic
906761613 1:48382863-48382885 CCCCCCTCCCCCCTCCCGGACGG + Intronic
907272519 1:53299195-53299217 CACCCCTCCCCACACAGGCAGGG - Intronic
912843500 1:113059683-113059705 CCCTCCTCCCCACACCTTCAGGG + Intergenic
913385662 1:118255829-118255851 CCTTCTTCACCACACAGGGAAGG - Intergenic
916697005 1:167248578-167248600 CCCTCCTCCCCACAAACTACTGG - Intronic
917050685 1:170919398-170919420 CCTTGCTCCCCACACAGGAATGG + Intergenic
917977685 1:180250861-180250883 CCCTCCTCAGCACACACTGTGGG - Intronic
918866574 1:189907677-189907699 CCATCCTCCCCACAGAAGTATGG - Intergenic
920600788 1:207321853-207321875 CCCTACTCACCCCACACGGCCGG - Exonic
922412133 1:225387230-225387252 CCCTCCCCCCCACACATGACAGG - Intronic
923034170 1:230272579-230272601 TCCTCCTCCCCTAACAGGGAGGG - Intronic
924040232 1:239977553-239977575 CCCTTCTCCGCACACACAGTTGG + Intergenic
924409333 1:243786805-243786827 CCCTTCTCCCCAAACATGGATGG - Intronic
1062826051 10:569754-569776 CCCTCCTACCCACAAAGGCAGGG + Intronic
1063663673 10:8049807-8049829 CCCTCCTCCCACCATAGGGAAGG + Intergenic
1064027440 10:11860048-11860070 CTCTCCTCCCCTCCCAGGGAAGG + Intronic
1064108532 10:12519848-12519870 CCCCCCTCCCCCCTCCCGGACGG + Intronic
1065513922 10:26506239-26506261 CCCCCCCCCCCACACACACACGG - Intronic
1065995457 10:31055798-31055820 CACTCCTCCCCACAAGCTGAGGG - Intergenic
1066065624 10:31759509-31759531 CCCCCCGCCCCACACACCGCAGG + Intergenic
1066085586 10:31970446-31970468 CCCCCCTCCCCCCTCCCGGACGG - Intergenic
1066461817 10:35619128-35619150 CCCTCCTCCCCAGGCGAGGATGG - Intergenic
1066502474 10:36007561-36007583 CACTCCTCCCCACCCAGGTAAGG - Intergenic
1067773054 10:49140854-49140876 CTTTCCTCCCCAGACATGGATGG - Intergenic
1068823576 10:61407768-61407790 CCCTCCCCCCAACACACAGTAGG - Exonic
1069641631 10:69959964-69959986 ACCTCATCCCCACACATGGCAGG - Intronic
1070483689 10:76909928-76909950 CCCTCCTCCTCACTCAAGGGTGG - Intronic
1071517779 10:86310426-86310448 CCCTCTACCCCACACAGGGCTGG - Intronic
1071583239 10:86793108-86793130 CCCGCCACCCCACACACACATGG + Intronic
1072506394 10:96071900-96071922 CCCCTCTCCCAACACACAGAAGG + Intergenic
1072526459 10:96276207-96276229 CTCTGCTACCCACACACTGATGG + Intergenic
1073449247 10:103600056-103600078 CCCTGCTCCCCACCCAGGCAGGG - Exonic
1076734338 10:132452050-132452072 CCCTTTCCCCAACACACGGACGG - Intergenic
1076853650 10:133104930-133104952 CCTTTCTCCCCACACCCCGAAGG + Intronic
1077223502 11:1427531-1427553 CCCTGCGCCCCCCACAGGGAAGG - Intronic
1077472205 11:2769380-2769402 CCATCCTCCCAACTCACAGAGGG - Intronic
1077647673 11:3940250-3940272 CTCTCCTCCCCTCACACCAACGG - Intronic
1078619348 11:12893163-12893185 CCTTCCTCCCCAAACCTGGAAGG - Intronic
1079027562 11:16961012-16961034 CCCTCCACCCCACTCAAGGAAGG + Intronic
1080766120 11:35298740-35298762 CCCTTCTCCCCAGAGATGGAGGG - Intronic
1080944666 11:36958124-36958146 CTCTCCTTCCCCCACATGGAGGG - Intergenic
1081502575 11:43680925-43680947 CCCCACTCCCCAGACCCGGAGGG - Exonic
1083170538 11:60921822-60921844 CCCTGCTCCCCACAGCAGGAAGG - Exonic
1083366915 11:62146931-62146953 CTCTCTTCCACACACATGGAAGG - Intronic
1083582269 11:63832594-63832616 ACCTCCACCCCACACACAGCTGG + Intergenic
1083632347 11:64102316-64102338 TCCTCTTCCACACAGACGGAGGG - Intronic
1083829636 11:65223378-65223400 CTCTCCTCCACACAGACGAAGGG + Intergenic
1083876905 11:65529075-65529097 CTGTCTTCCCCACACACGGCTGG - Intronic
1084977059 11:72807047-72807069 CACTCCTGCCCACCCAGGGAGGG + Intergenic
1085282742 11:75341644-75341666 CCCTCCTCCACACTCTCTGAGGG + Intronic
1087400962 11:97667056-97667078 CCCACCTCCCCACAAGCAGAGGG - Intergenic
1087876893 11:103369558-103369580 CCCTCCTCTCCTCAAACAGAAGG - Intronic
1089564872 11:119365380-119365402 CCCTCCTCCCACCACACTGCTGG - Intronic
1089565797 11:119370923-119370945 GCCTCCTCCCCACACAGGCATGG - Intronic
1089739828 11:120574765-120574787 CTCCCCTCCCCACAGACTGATGG - Intronic
1090906877 11:131084328-131084350 CCCCCCTCCCCCCTCCCGGACGG + Intergenic
1091165576 11:133472936-133472958 CCCACCTGCCCACACACTAATGG + Intronic
1091941908 12:4493206-4493228 CCCTCCTCCCCAAAAACGACAGG - Intronic
1092282722 12:7109614-7109636 CCCTCCTCCCCAAGCAGGGGTGG + Intergenic
1093377488 12:18448871-18448893 CCATCCTCCCCAACCACTGATGG + Intronic
1094541318 12:31365356-31365378 CCTTCCTCCCCACCCACAGTGGG - Intergenic
1094850497 12:34380255-34380277 GCCTCCTCACCACACATGCACGG - Intergenic
1096811843 12:54175592-54175614 ACCTCCTCCCCAGACTCTGAGGG + Intronic
1096874403 12:54615916-54615938 CCCTCCTCCCCACACCCGGGAGG - Intergenic
1097127966 12:56789461-56789483 CCCTCCTCCTCCCTCCCGGACGG + Intergenic
1097279307 12:57834723-57834745 CCCTCCCCATCACACACAGATGG - Intronic
1097632610 12:62081942-62081964 CCCTCCTCCCCACCCCCGACAGG + Intronic
1098412906 12:70202597-70202619 CCCCCCTCCCCCCTCCCGGACGG - Intergenic
1098913323 12:76232330-76232352 CTCTCCTTCCCCCACACAGAAGG + Intergenic
1102490298 12:113286484-113286506 CTCTCCTCTCCAGACACGCAGGG - Intronic
1102713842 12:114952816-114952838 CCCTCCACTCCACCCACAGAAGG + Intergenic
1103379105 12:120480120-120480142 CCATCTTCCTCACACAAGGAGGG - Intronic
1103760914 12:123249658-123249680 CACACCTCCCCACAAGCGGAGGG + Intronic
1103917844 12:124385182-124385204 CCCTCCTCCACAAGCACAGAAGG - Intronic
1103946802 12:124531659-124531681 CTCTCCTCCCCACCCAAGCAGGG + Intronic
1104413572 12:128579456-128579478 CCCTCCTCCCAACAAACGTCTGG + Intronic
1104591475 12:130087529-130087551 CCAACCTCCCCACACCCAGAGGG + Intergenic
1104871428 12:132001085-132001107 CTCTCGTCTCCACACACGGTGGG - Intronic
1105763106 13:23531527-23531549 CACACCTCCCCACAAACAGAGGG - Intergenic
1105889972 13:24675711-24675733 CCCGCCACCCCACACACAGAGGG + Intergenic
1106150875 13:27100507-27100529 CCCTCCTCCTCATCCACTGATGG + Intronic
1106460593 13:29964358-29964380 CCCTCCTCCACACAGCCTGATGG - Intergenic
1106662450 13:31814315-31814337 CTCTCCTTCCCCCACACAGAGGG - Intergenic
1109522802 13:63534538-63534560 CTCTCCTCTCCTCAAACGGAAGG + Intergenic
1110010050 13:70321067-70321089 CCCCCCTCCCCACAACAGGAAGG + Intergenic
1110219409 13:73058252-73058274 CCCTCCTCCCCACACACGGATGG + Intronic
1112197952 13:97243716-97243738 CTCTCCTCCCCACCCTTGGAGGG + Intronic
1112341656 13:98557501-98557523 TCCTCCTCCCCACCCACTGGTGG + Intronic
1113423943 13:110192514-110192536 CCCCCCTGCCCACACACCCAGGG + Intronic
1113783207 13:112988364-112988386 CCCTGCTCCCCACACCGGGCAGG - Intronic
1114199234 14:20506423-20506445 CCCCCCTCCCCCCTCCCGGACGG - Intronic
1114199457 14:20506923-20506945 CCCCCCTCCCCCCTCCCGGACGG - Intronic
1114427796 14:22637519-22637541 CCCCCCTCCCCCCTCCCGGACGG - Intergenic
1115703525 14:35977369-35977391 CCCCCCTCCCCCCTCCCGGACGG + Intergenic
1115715566 14:36099276-36099298 CCTCCCTCCCCAAATACGGAAGG + Intergenic
1115805596 14:37047510-37047532 CCCTGCTCCCCAAACCCAGATGG + Intronic
1117504987 14:56392857-56392879 CTCTCCTGCACACACACAGAAGG - Intergenic
1118340998 14:64895306-64895328 CCCCCCTCCCCCCTCCCGGACGG + Intergenic
1121210383 14:92203971-92203993 CCCACCTCCCCCAACAGGGAGGG - Intergenic
1121623182 14:95364415-95364437 CCCTCCTCCCCCCACACCCCAGG - Intergenic
1121924252 14:97913732-97913754 GCCCCCTCTCCACACAGGGAAGG + Intergenic
1122151431 14:99728155-99728177 ACCCCCTCCCCAAACAGGGAAGG + Intergenic
1122443976 14:101755760-101755782 CCCCCCTCCCTGCACACCGATGG + Intergenic
1122568457 14:102677214-102677236 CCCCCCTCCCCCCTCCCGGACGG + Intronic
1122599112 14:102912518-102912540 GCCTCCACCCCACACACGATGGG + Intergenic
1124604593 15:31161029-31161051 CGCTCCTGCCCACCCAGGGAGGG - Exonic
1125819089 15:42612543-42612565 CCCTCCTCCCTACAAAAAGATGG - Intronic
1125980551 15:43996362-43996384 CTCTCCTTCCCTCACACAGAGGG + Intronic
1126295448 15:47132729-47132751 CCCCCCTCCCCCCTCCCGGACGG - Intergenic
1127584453 15:60367053-60367075 CCCCCCTCCCCCCTCCCGGACGG - Intronic
1127584503 15:60367151-60367173 CCCCCCTCCCCCCTCCCGGACGG - Intronic
1130051114 15:80484780-80484802 CACTCCTCAGCACACACGGCTGG - Intronic
1130821767 15:87503340-87503362 CCCTGCTCCCCACTCACCCAGGG - Intergenic
1130908490 15:88255834-88255856 CCCTCCTGCCCACCCGCGGCCGG - Intronic
1132157074 15:99503130-99503152 CCCTCCTCCCCCCAAGCAGATGG - Intergenic
1132299999 15:100769294-100769316 CCTGCCTCCCCACTCAGGGATGG - Intergenic
1132379896 15:101359041-101359063 CCGTCCTCCCCACACACAGCAGG + Intronic
1135190563 16:20350878-20350900 CTCTCCTCCCCACAGCTGGAAGG + Intronic
1135415339 16:22264558-22264580 TCCACCTGCTCACACACGGAGGG + Intronic
1136136669 16:28260462-28260484 CCCTTCTCCCCACCCAGGGCAGG - Intergenic
1136572260 16:31104739-31104761 CCCCCCTCCCCCCTCCCGGACGG - Intergenic
1138444017 16:57051996-57052018 AACTTCTCCCCACCCACGGAGGG + Intronic
1139515793 16:67451660-67451682 CACTCCTCCCCTCACTCAGAAGG - Intronic
1141164828 16:81653362-81653384 CTCTACTCCACAGACACGGAGGG - Intronic
1141595575 16:85095012-85095034 CCCTCTTAGCCACACAGGGAGGG + Intergenic
1142494532 17:299350-299372 CCCTCCCTCCCTCCCACGGAAGG + Intronic
1142508223 17:379382-379404 CCCTCCTTCTCACTCATGGATGG - Intronic
1142818691 17:2447688-2447710 CCCCCCTCCCCCCTCCCGGACGG - Intronic
1142883881 17:2900961-2900983 CTCGCCTCCCCACCCTCGGAGGG - Intronic
1143487633 17:7263218-7263240 CCCTGCTCCCCACCCTCGGCCGG - Intronic
1143550934 17:7630088-7630110 CCCTCCACCGCCCACACGCAAGG + Intronic
1143705820 17:8697133-8697155 CCCTCCTCACCACCCCCAGAGGG - Intergenic
1144449491 17:15364391-15364413 CCCTCCTCCACCCACACTCAGGG + Intergenic
1146000199 17:29126286-29126308 CCCTCCTCCTCTCACAAGGGAGG - Intronic
1146053461 17:29569252-29569274 CCCTCCCCACCACACACACACGG + Intronic
1146216083 17:30979765-30979787 CCCCCCTCCCCCCTCCCGGACGG + Intronic
1146931785 17:36782957-36782979 CCCTCCACCCCACACCTAGAGGG - Intergenic
1147793409 17:43026789-43026811 TCCTCCTCCCAACATAAGGAGGG + Intronic
1148227927 17:45912073-45912095 CTCTCCCCACCACACAAGGAAGG + Intronic
1148461307 17:47840582-47840604 CCCTGCTCCCCACACCTGGGAGG - Intronic
1150636325 17:66915712-66915734 TCCTCCACCTCACACACAGAAGG + Intergenic
1151192249 17:72406998-72407020 CCCTCCTCCCCAGACACCAGTGG - Intergenic
1151694185 17:75705684-75705706 CCCTCCTCCTCACACCCAGGAGG - Intronic
1152020280 17:77776827-77776849 CCCCCCTCCCCCCTCCCGGACGG - Intergenic
1155212850 18:23618280-23618302 CCCCACTACCCACACACGGGCGG - Intronic
1155466410 18:26140366-26140388 CTCTCCTTACCACACATGGATGG + Intronic
1157385510 18:47256838-47256860 ACCTCCTCCCCATATAGGGAAGG + Intergenic
1157753036 18:50195059-50195081 GCCTCCTCCCCACACCTGGGAGG - Exonic
1158197046 18:54899460-54899482 CCCCACCCCCCACACACAGAAGG - Intergenic
1161087182 19:2340599-2340621 CCCACCTCCTCACCCAGGGACGG - Intronic
1162341113 19:10092007-10092029 CCCTCCTCCCCAGACTCTCATGG + Intronic
1163184488 19:15628439-15628461 CCCTCCTCCCCTGCCATGGAGGG - Intronic
1165415760 19:35692314-35692336 CCCTCCTCACCTCGCACTGAGGG + Intergenic
1166930408 19:46298365-46298387 CCCCCCTCCCCACCCAAGGCCGG + Intronic
1167596988 19:50432987-50433009 GCCCCATCCCCACACAGGGAGGG - Intronic
1167597010 19:50433070-50433092 GCCTCCTCCTCACACAGCGAAGG - Intronic
1167970776 19:53187156-53187178 CCCCCCTCCCCCCTCCCGGACGG + Intronic
925122123 2:1427466-1427488 CCCTCACCCCCACACACTCATGG - Intronic
925403499 2:3591135-3591157 CCCCCCTCCCCCCTCCCGGACGG + Intergenic
925613872 2:5726464-5726486 GCCTCCTTCCCAAACACTGACGG + Intergenic
926141921 2:10372942-10372964 CCCTCCTGCCCCCAGAAGGAGGG + Intronic
927854653 2:26520431-26520453 ACTTCCTCCCCTCACACAGATGG - Intronic
927897718 2:26795334-26795356 CCCTCCTCCTCCCTCCCGGAGGG + Intronic
928005338 2:27557870-27557892 CCCCCCTCCCCCCTCCCGGACGG + Intronic
928656074 2:33453005-33453027 CTCTCCTTCCCCCACAGGGAAGG + Intronic
931242507 2:60466135-60466157 CCCACCTTCCCACAAAGGGAGGG - Intronic
931855532 2:66298762-66298784 CTCCCCTCCACACACAAGGAGGG - Intergenic
932088431 2:68783064-68783086 CCCTCCTTCCCACTCACACAAGG + Intronic
932182638 2:69662427-69662449 CACCCCTCCCCACTCAGGGATGG - Intronic
932190551 2:69738516-69738538 CACCCCTCCCCACTCAGGGATGG + Intronic
932420524 2:71598765-71598787 GCCTCGTCCCCTCACAGGGAGGG + Intronic
932705823 2:74024361-74024383 CCCTTCCCTCCACACACAGAGGG - Intronic
933774840 2:85765708-85765730 CCCTCCTCTTCACCCAGGGAAGG + Intronic
933901775 2:86855330-86855352 CACTGCTCCCCACACATGGTTGG - Intronic
934564037 2:95328646-95328668 CCCTCCCCAGCACACAGGGACGG - Intronic
935778773 2:106493933-106493955 CACTGCTCCCCACACATGGCTGG + Intergenic
936012935 2:108936568-108936590 GCCTCCTCCCCACACCCAGCAGG + Intronic
936224615 2:110636640-110636662 CCCTCCTCCCACCCCACGGCAGG - Intergenic
937230542 2:120395982-120396004 CCCACCCCCCCACACACCGTCGG + Intergenic
939642504 2:144657354-144657376 CCCTCCTCCCCCACCACAGAAGG + Intergenic
939999740 2:148955098-148955120 CCCTCCTTCCCTCACAAGCAGGG + Intronic
940117478 2:150224842-150224864 CCCTACTCTCCACTCACTGAAGG - Intergenic
940643612 2:156369137-156369159 CCCCCCTCCCCCCTCCCGGACGG - Intergenic
941654932 2:168133117-168133139 TCCTCCTCCCCACACAGGAAGGG + Intronic
943739921 2:191398250-191398272 CCCCCCTCCCCCCTCCCGGACGG + Intronic
944598525 2:201283050-201283072 CCCCCCTCCCCCCTCCCGGACGG + Intronic
946182953 2:217959959-217959981 CCCTCCTCCCTTCACACGTGAGG - Intronic
946185653 2:217979049-217979071 CCCACCTTCCCGCACCCGGAGGG - Intronic
946443157 2:219714010-219714032 CCCTCCTCCTGGCTCACGGATGG - Intergenic
948206263 2:236164272-236164294 CCCTCCTTCCCCCACTCGAAAGG + Intergenic
948374514 2:237512613-237512635 CCCACCTCCCCACACGCACACGG + Intronic
948657111 2:239483377-239483399 CCCTCCTCGGGACACATGGATGG + Intergenic
1169247102 20:4033131-4033153 CCCCCCTCCCCCCTCCCGGACGG - Intergenic
1171353933 20:24529106-24529128 TCTTCCTCCCCACCCACTGAAGG - Intronic
1173000810 20:39104371-39104393 TCCTCTCCCCCACACACAGATGG - Intergenic
1173251276 20:41365410-41365432 GCCTCTTCCCCACGCAGGGAGGG - Intronic
1173262683 20:41450915-41450937 CCCTCCTCCCCATACCCTGGTGG - Intronic
1174365725 20:50055143-50055165 CCCCCCACCCCACGCACAGAGGG + Intergenic
1176198074 20:63846703-63846725 CCCTCCTCCCCACTCCCTGCAGG - Intergenic
1179479094 21:41666498-41666520 CTCTCCTCCTCACACACACATGG + Intergenic
1181522613 22:23458314-23458336 CCCTCCTCCCAACCCAGGGCTGG - Intergenic
1181586338 22:23855115-23855137 CCCCCCTCCCCCCTCCCGGACGG - Intergenic
1181593166 22:23896840-23896862 CCCTCCTGCCCTCACACAGCAGG - Intronic
1181684105 22:24516612-24516634 CCCTGCTCCCCACCCATGGCAGG - Intronic
1182538969 22:31027260-31027282 CCCCCCTCCCCCCTCCCGGACGG - Intergenic
1183070715 22:35394118-35394140 CCTCCCTCCCCACCCACGCATGG - Exonic
1183341119 22:37282424-37282446 ACTTCCTCCCCACACAGGGCTGG + Exonic
1183341330 22:37283557-37283579 CCTTCCTCCCCACCCCCAGATGG + Intronic
1183511388 22:38237184-38237206 CCCTCATTCCCCCACAAGGAAGG + Intronic
1183871524 22:40745140-40745162 CCCCCCTCCCCCCTCCCGGACGG + Intergenic
1183952485 22:41359396-41359418 CCCTCCTAATCACACAAGGATGG - Exonic
1183999792 22:41664899-41664921 CCCTCTTGCCCAGACACGTAAGG - Intergenic
1184133107 22:42529584-42529606 CTGTCCTCCCCACACTCAGAAGG + Intergenic
1184504138 22:44890969-44890991 CTCTCTTCCCCACACGCGGGCGG - Intronic
1185192893 22:49450020-49450042 CCCGCCTCCCCCCACAGGAAAGG + Intronic
949120863 3:382027-382049 CCCCCCACCCCACATATGGAAGG - Intronic
949949491 3:9217485-9217507 CCCTCCTCCCCGCAAAAGGAAGG + Intronic
950145024 3:10642855-10642877 GCTTCCTCCCCATACACTGAGGG + Intronic
950520672 3:13496009-13496031 CCCTGCTCCCCACCCACGCGAGG - Intronic
950719880 3:14875293-14875315 CCCACATCCACACACAAGGAAGG - Intronic
953918234 3:46934359-46934381 CTCTTTTCCCCACACAGGGAGGG + Intronic
954224289 3:49172458-49172480 CCCTCCTTCCCACTCCAGGAGGG + Intronic
954488102 3:50873447-50873469 CTCTCCTCTCCTCACACAGAAGG + Intronic
954880560 3:53833341-53833363 CCACCCTCCCCACACAAGGGAGG + Intronic
954934417 3:54313505-54313527 CCCACCTCCCCACATCAGGATGG + Intronic
955521845 3:59783021-59783043 CCCTACTCCCCAGACACCTAGGG - Intronic
955996642 3:64686090-64686112 CCCTCCACAACACACACTGAAGG + Intronic
956081980 3:65567002-65567024 CCCTGCTCCCTCCACAGGGAGGG + Intronic
956780147 3:72597128-72597150 CCTTCCTTCCCAGACAGGGAGGG + Intergenic
956916401 3:73876392-73876414 CCTTCCACCCCACACCCAGAAGG - Intergenic
961439257 3:126942902-126942924 TACTCCCCCCCACACACAGATGG - Intronic
962385049 3:134926129-134926151 CCCCCATCCCCACACAGCGATGG - Intronic
963244561 3:143047326-143047348 CCCCCCTCCCCCCTCCCGGACGG + Intronic
963911531 3:150820851-150820873 CCCCCCTCCCCCCTCCCGGACGG + Intergenic
966098636 3:176239066-176239088 CCCCCCTCCCCCCACCCTGATGG + Intergenic
966235788 3:177700471-177700493 CCCTCCTACCCACACCTGCAAGG + Intergenic
967176171 3:186864517-186864539 CCCCCCTCCCCCCTCCCGGACGG - Intergenic
968047334 3:195631617-195631639 CACCGCTGCCCACACACGGAAGG + Intergenic
968307279 3:197658307-197658329 CACCGCTGCCCACACACGGAAGG - Intergenic
968513079 4:1003760-1003782 CCCTTCACCCCACACACTGTGGG + Intronic
968673708 4:1865789-1865811 TCCTCCTCCCCACAGCCAGAGGG + Intergenic
968700855 4:2057796-2057818 CCCGCCTCCCCACTCACGCCCGG + Intergenic
968882298 4:3307604-3307626 CCCTCCTCCCCTCACTCGGCAGG + Intronic
969695314 4:8730917-8730939 CCTCCCTCCCCACACACTGAGGG - Intergenic
970409383 4:15791284-15791306 CCCCCCTCCCCCCTCCCGGACGG - Intronic
970427915 4:15962768-15962790 CCAGCCTCCCTGCACACGGATGG + Exonic
971217137 4:24672165-24672187 CTCTCCTTCCCACACACCCAAGG - Intergenic
972278556 4:37581966-37581988 CCAGCCTACCCACACACAGAGGG - Intronic
972553808 4:40160985-40161007 CCCTCCTTCCCACCCCCAGAAGG + Intergenic
973159226 4:46994287-46994309 CCCTCCTCTCCAGAAAAGGATGG - Exonic
973245086 4:48002859-48002881 CCCTCCTCCCCACAGCCTGATGG + Intronic
975440001 4:74399448-74399470 CACACCTCCCCACAAACTGAGGG + Intergenic
975685713 4:76917158-76917180 CCCCCCTCCCCCCTCCCGGACGG - Intergenic
976263835 4:83171869-83171891 CCCTCCTCCCAACCCCCAGATGG + Intergenic
977927069 4:102713403-102713425 CTCCCCTCCCCACACATGAAGGG + Intronic
978929829 4:114296486-114296508 CCCACCTCCCCACAAACAGAGGG + Intergenic
981531279 4:145756024-145756046 CCTTCGTCCCCACAGACTGAAGG + Intronic
982206990 4:153004289-153004311 TCCTCCTCCCCACACACTCTGGG - Intergenic
984136596 4:175948381-175948403 CCCTCCTCCCGGCCCACAGATGG - Intronic
984804011 4:183736464-183736486 CCCCCCTCCCCCCTCCCGGATGG + Intergenic
985519924 5:369373-369395 CCCTCCTGCCCACAGCCTGAAGG + Intronic
985780206 5:1866633-1866655 CCCTCCTCCCCCCACAGGCCAGG + Intergenic
986257572 5:6113309-6113331 CCCTCCACCCAACACTGGGATGG - Intergenic
986345756 5:6833753-6833775 CCCTCATCCCCAGACCTGGATGG + Intergenic
986733119 5:10649621-10649643 GCCTCTTCCCCACGCTCGGAGGG - Exonic
987067613 5:14304741-14304763 CCCCACTCCCCACACACACAGGG - Intronic
987369838 5:17182783-17182805 CCCTCCTCTCCCCACAATGAGGG - Intronic
988502108 5:31792196-31792218 CCCTGCTCCTCAGCCACGGATGG - Intronic
992894349 5:81233561-81233583 CCCTCCTCCCTGCACACAGGTGG + Intronic
996300083 5:121971439-121971461 CCCCCCTCCCCACAAAAGAAGGG + Intronic
996436384 5:123437414-123437436 CTCTCCTCCCCACACTCTAAAGG + Intergenic
998456980 5:142281035-142281057 CCTTCCTCTCCACAAACCGAGGG - Intergenic
998757884 5:145400671-145400693 CCCTCCTTCCCACAGACTGGTGG - Intergenic
998933747 5:147211182-147211204 CCCTGCTTCCCTCACAGGGATGG + Intergenic
1000497332 5:162001281-162001303 CCCTCCTCCCCTTACACAGATGG - Intergenic
1001470714 5:172010567-172010589 CCTTCCTCCCCACACACAAAGGG + Intergenic
1002576552 5:180177279-180177301 CCCACCTCCCCACCCAGTGAAGG + Intronic
1002591977 5:180296823-180296845 CCCCCCCCCCCACACACACACGG + Intergenic
1003298616 6:4856433-4856455 CCCTCCTCGCCAGACACGACTGG - Intronic
1003309395 6:4956284-4956306 CCTTCCTCCTCACCCACGCAGGG - Intergenic
1003319354 6:5037820-5037842 CCCCCCTCCCCCCTCCCGGACGG + Intergenic
1003425157 6:5994368-5994390 CTCTCCTCCCCTCACCCGGTGGG + Intergenic
1005069747 6:21851902-21851924 CCCCCCTCCCCCCTCCCGGACGG + Intergenic
1005825143 6:29627893-29627915 CCCTCCTCCCCACAAAATCAGGG - Intronic
1005837381 6:29719093-29719115 CCCCCCTCCCCCCTCCCGGACGG - Intergenic
1006906805 6:37538299-37538321 CCCTCCTGACCACACAGAGAGGG - Intergenic
1006963531 6:37958738-37958760 CCCCCTTCCCCACCCACCGACGG + Intronic
1007385298 6:41516470-41516492 CCCTCCTCCCCAGGCTCTGAAGG + Intergenic
1007718222 6:43869643-43869665 CCCTCTTCCCCACACAGAGCTGG - Intergenic
1008314662 6:50025582-50025604 CTCTCCTACCCTCACATGGAAGG - Intergenic
1009683462 6:66927048-66927070 AGCTCCCCCCCACACAAGGAGGG + Intergenic
1009978684 6:70701036-70701058 CTCTTCTCTCCTCACACGGAAGG + Intronic
1011459718 6:87590279-87590301 CCCTCCTCTCCAGCCAGGGAAGG - Intronic
1013019407 6:106197568-106197590 CACTCCTCCACACCCAGGGAGGG - Intronic
1013161557 6:107550006-107550028 CCCTCCTCTCCACACCTGGAAGG + Intronic
1013298593 6:108781752-108781774 CACTCCTCCTCACCCAAGGAGGG - Intergenic
1014274613 6:119373543-119373565 CGCTCATCCCCACTGACGGATGG - Intergenic
1014764011 6:125388800-125388822 CCCCCCTCCCCCCTCCCGGACGG + Intergenic
1018845452 6:167552291-167552313 CCCTCCTGCGCACACGTGGAAGG + Intergenic
1018889905 6:167976276-167976298 TCCTCCTCCCAACACACTGCAGG - Intergenic
1018889918 6:167976318-167976340 TTCTCCTCCCCACACACTGCAGG - Intergenic
1018889958 6:167976444-167976466 TCCTCCTCCCAACACACTGCAGG - Intergenic
1018889993 6:167976570-167976592 TCCTCCTCCCAACACACTGCAGG - Intergenic
1019222549 6:170485479-170485501 CCATCATCCCCAGCCACGGACGG + Intergenic
1019508317 7:1404698-1404720 CCCTCCTCACCACACCCAGGGGG - Intergenic
1019588714 7:1818230-1818252 CCCTCCTCCCAACCCAGGGCTGG + Intronic
1020705051 7:11533728-11533750 CCCTGCTCCCCACACCCGACAGG - Intronic
1022230997 7:28411545-28411567 CCCCCCACCCCCCACACCGAGGG - Intronic
1022300796 7:29100357-29100379 GCCTCCTCCCCACAGACCAATGG - Intronic
1022663587 7:32387861-32387883 CCCCCCTCCCCCCTCCCGGACGG + Intergenic
1022693281 7:32679716-32679738 CCCTCATCCCCAGTCACGCAGGG - Intergenic
1024055067 7:45654943-45654965 CCCTTCCCGCCACACAAGGATGG + Intronic
1025853072 7:65258726-65258748 CCCCCCTCCCCCCTCCCGGACGG - Intergenic
1025853256 7:65259127-65259149 CCCCCCTCCCCCCTCCCGGACGG - Intergenic
1026773896 7:73219234-73219256 CCCTCATCCACACACACCCAAGG + Intergenic
1027014753 7:74772624-74772646 CCCTCATCCACACACACCCAAGG + Intergenic
1027073278 7:75173331-75173353 CCCTCATCCACACACACCCAAGG - Intergenic
1027134086 7:75611965-75611987 CCCAGCTCCCCACACAAGCAAGG - Intronic
1028727134 7:94100868-94100890 CACACCTCCCCACAAACAGAGGG - Intergenic
1028984890 7:97002087-97002109 CCCTCCTCCTCCCACCCGCAAGG + Intergenic
1029404681 7:100367378-100367400 CCCTTCTCCCCACACTCTGTTGG - Exonic
1030127474 7:106168305-106168327 CCCTCTTCCACACAGACAGAGGG - Intergenic
1030910363 7:115240898-115240920 CCCTTCCCCCCACACACGCATGG + Intergenic
1031654928 7:124343148-124343170 CCCTCTTCACCACACACTGTGGG + Intergenic
1033620556 7:143058485-143058507 CTCTCCTCCACAGACACAGAAGG + Intergenic
1034438778 7:151076268-151076290 GCCACCTCCCCACACACAGCTGG + Exonic
1034518790 7:151603128-151603150 CCATACTCACCGCACACGGAGGG + Intronic
1034518795 7:151603158-151603180 CCGTCCTCACCGCACACGGAGGG + Intronic
1034518801 7:151603188-151603210 CCGTCCTCACCGCACACGGAGGG + Intronic
1034518807 7:151603218-151603240 CCGTCCTCACCGCACACGGAGGG + Intronic
1034518813 7:151603248-151603270 CCGTCCTCACCGCACACGGAGGG + Intronic
1034518819 7:151603278-151603300 CCGTCCTCACCGCACACGGAGGG + Intronic
1034518825 7:151603308-151603330 CCGTCCTCACCGCACACGGAGGG + Intronic
1034518838 7:151603368-151603390 CCGTCCTCACCGCACACGGAGGG + Intronic
1034518844 7:151603398-151603420 CCGTCCTCACCGCACACGGAGGG + Intronic
1034518850 7:151603428-151603450 CCATCCTCACCGCACACGGAGGG + Intronic
1034518863 7:151603488-151603510 CCGTCCTCACCGCACACGGAGGG + Intronic
1034518876 7:151603548-151603570 CCGTCCTCACCGCACACGGAGGG + Intronic
1034518882 7:151603578-151603600 CCGTCCTCACCGCACACGGAGGG + Intronic
1034518888 7:151603608-151603630 CCGTCCTCACCGCACACGGAGGG + Intronic
1035133252 7:156675302-156675324 CCCTCGTCTCCAAAGACGGAGGG - Intronic
1035842940 8:2832192-2832214 CCCTCCTCCCCACAGACTCACGG - Intergenic
1036563150 8:9914364-9914386 CCCACCACCCCACACACAGTGGG - Intergenic
1038056099 8:23859168-23859190 CCCTGCTCCCCGCACCCTGAGGG - Intergenic
1038571655 8:28667708-28667730 CCCCCCTCCCCCCACACCAAGGG - Intronic
1038583775 8:28771767-28771789 CCCTCCTCCCTGCACAAGGCTGG + Intronic
1038595291 8:28881460-28881482 CCCCCCTCCCCCCTCCCGGACGG - Intronic
1039228784 8:35419921-35419943 CTCCCCACCCCACACACAGAGGG - Intronic
1039764783 8:40616729-40616751 CCCTCCCCCCAACCCACGGCAGG - Intronic
1041715367 8:60927248-60927270 CCCTCCTCCCCATTCCTGGAAGG + Intergenic
1043113312 8:76215906-76215928 CCCACCTACCCACAGACAGATGG - Intergenic
1043441819 8:80283033-80283055 ACCACCTCCCCTCACACGGTGGG - Intergenic
1045120275 8:99028576-99028598 CCCCCCTCCCCCCTCCCGGACGG + Intronic
1045300095 8:100903492-100903514 CCCTCCTCCCCAGGCACTGCAGG + Intergenic
1046636403 8:116679101-116679123 CCCCCCTCCCCCCTCCCGGACGG - Intronic
1048881027 8:138872640-138872662 GCCTCCGCCCCACACACTGCAGG + Intronic
1049437778 8:142595624-142595646 CCCTCCTCTCAACACACTGCAGG + Intergenic
1049559156 8:143299335-143299357 CCCTCTTCCCAACAACCGGAGGG - Intergenic
1049653634 8:143788315-143788337 CCCTGCTCCACAGACAAGGAGGG + Intergenic
1050145148 9:2559774-2559796 CTCTCCTCCCCACAAACAGAAGG - Intergenic
1050386484 9:5096488-5096510 CCACCCTCCCCCCACATGGAGGG - Intronic
1052858734 9:33423645-33423667 CCCTCCACCCCCCTCCCGGACGG - Intergenic
1054869506 9:70036306-70036328 CCATCCACCCAACACAGGGAAGG - Intergenic
1055483559 9:76734179-76734201 CCCTCCTTTCCACAGAAGGAGGG - Intronic
1058829438 9:108802161-108802183 CTCTCCTCCCCCCACCCTGATGG - Intergenic
1061900501 9:133669741-133669763 CCGTCATCCCCACTCACGAATGG - Intronic
1061994799 9:134177922-134177944 CCCCATTCCCCACACACGGGAGG - Intergenic
1062035858 9:134382232-134382254 CCTTCCTCCCCACATGCGGCCGG - Intronic
1062053932 9:134461114-134461136 CCCGCCTCCCCACAGGCAGAGGG - Intergenic
1062136211 9:134929749-134929771 CCCTGCTCCTCACACAGGCATGG - Intergenic
1062474467 9:136720359-136720381 CCCTCCTCCCCAACCCTGGAGGG + Intronic
1185687531 X:1941546-1941568 GCTTCCTCCGCACACACCGAGGG + Intergenic
1186975381 X:14896665-14896687 CCGTGCTCCACACACACGCACGG + Intronic
1188338650 X:28971794-28971816 CCCTCATCCCCAAATACAGATGG - Intronic
1188489471 X:30722554-30722576 CACTCCTCCCCATAAACGAATGG + Intronic
1188862317 X:35272009-35272031 CTCTCCTTCCCCCACATGGAGGG + Intergenic
1189837947 X:45041180-45041202 CCCCCCTCCCCCCTCCCGGACGG + Intronic
1190779088 X:53578563-53578585 CCCCCCTCCCCCCTCCCGGACGG - Intronic
1194641211 X:96406047-96406069 CCCTCCTCCCCTCAGCCTGATGG - Intergenic
1195683081 X:107563255-107563277 CCCTCCTGCCCCCACACCCAAGG - Intronic
1197632317 X:128875917-128875939 CTCTCCTTCCCTCACATGGAAGG - Intergenic
1200045544 X:153398981-153399003 CCCTCACCCCCACACACGTAGGG - Intergenic
1200142720 X:153909915-153909937 CTCTCCTCCCCAGACCTGGAGGG - Exonic
1201678934 Y:16620570-16620592 CCATCCTCCCCATATATGGAGGG + Intergenic