ID: 1110219583

View in Genome Browser
Species Human (GRCh38)
Location 13:73059219-73059241
Sequence GGCTGCCGGCGGAGGAGGGG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 943
Summary {0: 1, 1: 1, 2: 5, 3: 92, 4: 844}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110219583_1110219599 19 Left 1110219583 13:73059219-73059241 CCTCCCCTCCTCCGCCGGCAGCC 0: 1
1: 1
2: 5
3: 92
4: 844
Right 1110219599 13:73059261-73059283 CCAAGCCAGCGTGGGCGAGGTGG 0: 1
1: 0
2: 4
3: 20
4: 216
1110219583_1110219594 11 Left 1110219583 13:73059219-73059241 CCTCCCCTCCTCCGCCGGCAGCC 0: 1
1: 1
2: 5
3: 92
4: 844
Right 1110219594 13:73059253-73059275 TCGCCGACCCAAGCCAGCGTGGG 0: 1
1: 0
2: 0
3: 1
4: 17
1110219583_1110219593 10 Left 1110219583 13:73059219-73059241 CCTCCCCTCCTCCGCCGGCAGCC 0: 1
1: 1
2: 5
3: 92
4: 844
Right 1110219593 13:73059252-73059274 CTCGCCGACCCAAGCCAGCGTGG 0: 1
1: 0
2: 0
3: 3
4: 58
1110219583_1110219596 16 Left 1110219583 13:73059219-73059241 CCTCCCCTCCTCCGCCGGCAGCC 0: 1
1: 1
2: 5
3: 92
4: 844
Right 1110219596 13:73059258-73059280 GACCCAAGCCAGCGTGGGCGAGG 0: 1
1: 0
2: 0
3: 11
4: 127
1110219583_1110219600 20 Left 1110219583 13:73059219-73059241 CCTCCCCTCCTCCGCCGGCAGCC 0: 1
1: 1
2: 5
3: 92
4: 844
Right 1110219600 13:73059262-73059284 CAAGCCAGCGTGGGCGAGGTGGG 0: 1
1: 0
2: 1
3: 8
4: 132

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110219583 Original CRISPR GGCTGCCGGCGGAGGAGGGG AGG (reversed) Exonic
900019998 1:181574-181596 GGCTGGGGGCGGGGGGGGGGGGG + Intergenic
900205006 1:1427922-1427944 GGCTGCGGGCGGGGGAGGCCGGG - Intergenic
900300316 1:1973715-1973737 GGCTGCCGGAGGGAAAGGGGAGG + Intronic
900313850 1:2047646-2047668 TGATGCCGCCGGTGGAGGGGGGG - Intergenic
900428084 1:2589538-2589560 TGCTGCCGGCGGATCAGGAGAGG - Exonic
900511193 1:3061935-3061957 GGCTGACGGTGTGGGAGGGGTGG + Intergenic
900624642 1:3602654-3602676 GGCTGGGGGTGCAGGAGGGGTGG - Intronic
900703141 1:4060372-4060394 GGCTGCTGGCGAAGGGGGAGAGG + Intergenic
900738049 1:4311657-4311679 GGCTGCCTGCAGAGGAGGTCGGG - Intergenic
900881886 1:5388191-5388213 GGCTCCTGGCTGAGGAAGGGAGG - Intergenic
900964036 1:5945199-5945221 GGCTGTGGGGGGAGGTGGGGAGG - Intronic
901058380 1:6460246-6460268 GGTTTCCAGCGCAGGAGGGGAGG - Exonic
901059941 1:6467346-6467368 GGCTGCCTGGGCAGGTGGGGTGG + Exonic
901062052 1:6476070-6476092 TGCTGCAGGCTAAGGAGGGGCGG - Intronic
901086690 1:6615072-6615094 GGCTGCCGCGGGAGGGCGGGTGG + Intronic
901223261 1:7596130-7596152 GGCTGCCTGCAGATGAGGGTGGG + Intronic
901279980 1:8026374-8026396 GGCTGCGGGAGGAGGCGGGGCGG - Intergenic
901373244 1:8818008-8818030 GGCGGGCGGCGGAGGAGGGCCGG - Intergenic
901641399 1:10694771-10694793 GGCTCCGGGAGGAGGAGGCGGGG + Intronic
901687001 1:10948569-10948591 GGCTGGCGGTGAAGGAGAGGAGG + Exonic
901768484 1:11518652-11518674 GGCTGCCGAGGGAGGAGGCTGGG - Intronic
902585731 1:17437954-17437976 GGCCCGCGGCGGGGGAGGGGCGG - Intronic
902630253 1:17700568-17700590 AGGTGCGGGCGGGGGAGGGGAGG + Intergenic
902690580 1:18108096-18108118 AGCTGGCGGCGGTGGCGGGGCGG - Exonic
902839687 1:19067058-19067080 GGCTGCCGGGACAGGAAGGGAGG + Intergenic
903224855 1:21888690-21888712 AGCGGCCGGCGGGGGTGGGGGGG + Intronic
903305642 1:22411133-22411155 GGCGGCCGGGGGCTGAGGGGAGG - Intergenic
903346187 1:22685698-22685720 GGCTGCTGTGGGAGGATGGGAGG - Intergenic
903652967 1:24932320-24932342 GGCGGCGGGGGGAGGGGGGGCGG + Intronic
903686518 1:25136016-25136038 GGGGGCCGGCGGAGTTGGGGGGG - Intergenic
904236936 1:29122423-29122445 CGCTGCGGGCGGAGGAGGTCTGG - Exonic
904461949 1:30685655-30685677 GGCTGGAGGCGGAGGGCGGGAGG + Intergenic
904814091 1:33182123-33182145 CGCAGCGGGCGGGGGAGGGGCGG + Intergenic
904837676 1:33349688-33349710 GGCTCCCGGCGGAGAGGAGGCGG - Intronic
905091537 1:35434610-35434632 GTCTGCCCTCGGGGGAGGGGAGG + Exonic
905183969 1:36183053-36183075 GGGTGATGGCTGAGGAGGGGAGG - Intergenic
905455610 1:38086007-38086029 GGCTGCTGGCTGGGGCGGGGTGG + Intergenic
905878668 1:41449454-41449476 AGCTGCTGGCGGAGCAGTGGGGG + Intergenic
905912233 1:41662629-41662651 GGCTGCCGGCGGCCGCGGGGAGG + Intronic
905960118 1:42035996-42036018 GGCGGTGGGCGGAGGAGGCGGGG - Intergenic
906140165 1:43529624-43529646 AGCGGCGGGGGGAGGAGGGGTGG + Intronic
906147590 1:43569221-43569243 GGCTGCAGGGGGTGGGGGGGGGG - Intronic
906168956 1:43707760-43707782 CGCGGCCGGCGGGGGAGGGGCGG - Intronic
906354477 1:45092536-45092558 GGCTGGCGGGGGGGGGGGGGTGG - Intronic
906365476 1:45206215-45206237 GGCAGCCGGCGGAGGGGCAGGGG - Exonic
906521925 1:46472340-46472362 GGCTGGGGGCGGTGGAGGGGAGG - Intergenic
906653856 1:47533670-47533692 GGGGGCGGGCGGAAGAGGGGAGG + Intergenic
907178948 1:52553190-52553212 GGTTGCCGGGGGAGAGGGGGAGG + Intronic
908203279 1:61819602-61819624 GGCGGCAGGCGGCGGTGGGGGGG + Intronic
908360834 1:63367475-63367497 GGCGGCCGGCTTAGGAGGCGGGG - Intergenic
908474032 1:64470905-64470927 GGCTGGCGGCCGAGGAGCTGGGG + Exonic
908527584 1:65002688-65002710 GGCCGGCGGCGGCGGAGGCGGGG + Intergenic
908582046 1:65525986-65526008 GGCGGGCGGCGGGGGTGGGGTGG + Intronic
908971795 1:69844358-69844380 GGCTGCCAGGGGCTGAGGGGAGG - Intronic
910449554 1:87331624-87331646 GGCGGGCGGCGGAGGAGGGGAGG + Intronic
912167320 1:107056751-107056773 GGGCGGCGGCGAAGGAGGGGAGG + Exonic
913959351 1:143327137-143327159 GGCGGACGGCGGCGGAGAGGCGG + Intergenic
913959363 1:143327181-143327203 GGCGGACGGCGGCGGAGAGGCGG + Intergenic
913959375 1:143327225-143327247 GGCGGACGGCGGCGGAGAGGCGG + Intergenic
913959387 1:143327269-143327291 GGCGGACGGCGGCGGAGAGGCGG + Intergenic
913959398 1:143327313-143327335 GGCGGACGGCGGCGGAGAGGCGG + Intergenic
913959574 1:143327985-143328007 GGCTGCAGACAGAGGAGTGGAGG + Intergenic
913972331 1:143424295-143424317 GGCTGCAGACGGAGGAGTGGAGG - Intergenic
914053681 1:144152561-144152583 GGCGGACGGCGGCGGAGAGGCGG + Intergenic
914053706 1:144152649-144152671 GGCGGACGGCGGCGGAGAGGCGG + Intergenic
914053933 1:144153558-144153580 GGCTGCAGACAGAGGAGTGGAGG + Intergenic
914066713 1:144249908-144249930 GGCTGCAGACGGAGGAGTGGAGG - Intergenic
914112440 1:144716446-144716468 GGCTGCAGACGGAGGAGTGGAGG + Intergenic
914125213 1:144812807-144812829 GGCTGCAGACAGAGGAGTGGAGG - Intergenic
914125426 1:144813654-144813676 GGCGGACGGCGGCGGAGAGGCGG - Intergenic
914125438 1:144813698-144813720 GGCGGACGGCGGCGGAGAGGCGG - Intergenic
914125450 1:144813742-144813764 GGCGGACGGCGGCGGAGAGGCGG - Intergenic
914125463 1:144813786-144813808 GGCGGCCGGCGGCGGAGAGGCGG - Intergenic
914125468 1:144813804-144813826 GGCGGACGGCGGCGGAGAGGCGG - Intergenic
914125480 1:144813848-144813870 GGCGGACGGCGGCGGAGAGGCGG - Intergenic
914125492 1:144813892-144813914 GGCGGACGGCGGCGGAGAGGCGG - Intergenic
914125504 1:144813936-144813958 GGCGGACGGCGGCGGAGAGGCGG - Intergenic
914125516 1:144813980-144814002 GGCGGACGGCGGCGGAGAGGCGG - Intergenic
914176046 1:145281003-145281025 GGCTGTGGGCGGTGGGGGGGTGG + Intergenic
914803160 1:150974758-150974780 GGCGGCTGGCGGAGGAGGGAGGG - Exonic
915141434 1:153770943-153770965 AGCTGCCCTCGGAGGTGGGGAGG + Intronic
915165710 1:153946677-153946699 GGCCGCCGGCCGAGGAGGAGGGG - Exonic
915445299 1:155971082-155971104 GCCTGCGTGAGGAGGAGGGGAGG - Intronic
915467643 1:156106658-156106680 CGCTGCCGGGGGCGGTGGGGGGG - Intronic
915472786 1:156135887-156135909 GGCTGCCAGCTGAAGGGGGGTGG - Exonic
915472810 1:156135971-156135993 GGCTGCTGGCGGAAAAGGAGCGG + Exonic
915474780 1:156147136-156147158 GGCTTCCAGGGGAGTAGGGGAGG + Intergenic
915513991 1:156402180-156402202 GGCTCCCGGCGGGGGAGCTGGGG - Intergenic
915528250 1:156489178-156489200 GGCTGCAGGCTGAGGACTGGAGG + Intronic
915557483 1:156668626-156668648 GGCTGCCTCCTGAGGAGAGGAGG - Intergenic
916660874 1:166921378-166921400 GGCTGCGGGCAGAGAAGGAGGGG + Exonic
919807169 1:201387004-201387026 GGCTGGAGGCAGAGGAGGGGAGG - Exonic
919820463 1:201468994-201469016 GGGTGCCGGCTGAAGCGGGGCGG - Exonic
920533536 1:206722731-206722753 GGCTGCAGGCCGAGGGGGGCTGG - Intronic
921325316 1:213982739-213982761 GGCGGGCGGCGGGGGAGGAGAGG + Intergenic
922341205 1:224656536-224656558 GGCGGCGGGCGGCGGGGGGGCGG + Intronic
922739729 1:228008280-228008302 GGCTGCCGTCGGAGAAGGATGGG - Intronic
922811155 1:228416420-228416442 GGCGGCCGGCGGAGGCGGGAAGG + Intronic
922936546 1:229427166-229427188 GGCTGCTGGCGGAGAGGAGGTGG - Intergenic
923007947 1:230067188-230067210 GGGGGCCGGGGGAGGAGCGGAGG - Exonic
924381969 1:243473913-243473935 AGTTGCCGGCGGGGGGGGGGGGG + Intronic
924436629 1:244048786-244048808 GGCTGCCAGCGGGGGTGGGCGGG + Intergenic
1062907266 10:1187370-1187392 GGGAGCGGGAGGAGGAGGGGAGG - Intronic
1062907279 10:1187405-1187427 GGGAGCAGGAGGAGGAGGGGAGG - Intronic
1063664715 10:8054457-8054479 GGCCGCCGGCGGAGGGGCGGCGG - Intronic
1063664716 10:8054460-8054482 GGCGGCCGCCGGCGGAGGGGCGG - Intronic
1063671535 10:8103388-8103410 GGCTGGAGGCGGGGGGGGGGGGG + Intergenic
1064662991 10:17625076-17625098 GGTTGCCAGGGGAGGAGGTGGGG - Intergenic
1065140382 10:22714103-22714125 AGCTGCAGCCGGAGGAGGAGGGG + Intronic
1065712757 10:28533224-28533246 GGCGGCGGGGGGAGGAGGGGAGG + Intronic
1066299827 10:34086931-34086953 TGCTTCCGGTGGAGGAGGGCTGG - Intergenic
1067343109 10:45419842-45419864 GGGTGCCTGTGGAGGAAGGGAGG + Intronic
1069546738 10:69334524-69334546 CGCTGCCGGGGGAGAAGGGCTGG + Intronic
1069583139 10:69578601-69578623 GGAACCCGGCGGGGGAGGGGAGG + Intergenic
1069710721 10:70486852-70486874 GGCTGCCTCGGGAGGAAGGGAGG - Intronic
1069771857 10:70905454-70905476 GCCTGCCGGGAGTGGAGGGGAGG - Intergenic
1069857033 10:71447042-71447064 GGCTGTCGGTGGAGGTGGGCAGG - Intronic
1069882400 10:71601949-71601971 GGTGGGCGGCGGAGGGGGGGGGG + Intronic
1069955004 10:72044610-72044632 GGCTGCCCGTGGAGGTGGGTAGG - Intergenic
1070087693 10:73252655-73252677 GGCGGCAAGCGGAGGAGGCGTGG - Exonic
1070353022 10:75611532-75611554 GGCTGCCTGGGGCTGAGGGGAGG - Intronic
1070570794 10:77638200-77638222 CGCAGCCGGGGGAGGAGGGCTGG - Intronic
1071311355 10:84347386-84347408 GGCGGCTGGCCGGGGAGGGGGGG + Intronic
1072637364 10:97186434-97186456 TGCTGCCGTCGGGGGATGGGGGG - Intronic
1072699929 10:97633321-97633343 GGCTGGAGGCGCAGGAGGGAGGG - Intronic
1072915855 10:99537005-99537027 GGCCGCCGGGGGAGAAGGGAGGG - Intergenic
1073025219 10:100482644-100482666 GGCTGGCGGTGGAGGAGCGCCGG + Exonic
1073449027 10:103598679-103598701 GGCAGCAGGCAGAGGAGGGAGGG - Exonic
1074412250 10:113238446-113238468 GGCTGGCGGAGGAGGTAGGGTGG + Intergenic
1075430399 10:122375123-122375145 GGCGCCCGGCGGGGGAGGGCGGG + Intronic
1075885426 10:125896025-125896047 GGCTCCCGGAGCAGGAGGCGCGG + Intronic
1076138209 10:128059344-128059366 GGCTGCCAGCAGAGAAAGGGCGG - Intronic
1076143157 10:128095721-128095743 GGGTGGCAGCGGGGGAGGGGGGG + Intergenic
1076642721 10:131929704-131929726 AGCTGCCGGTGGTGGCGGGGAGG - Intronic
1076751448 10:132545461-132545483 GGGTCCAGGCGGAGGAGGGTGGG + Intronic
1076815184 10:132911132-132911154 GGCTGGAGGCTGCGGAGGGGAGG - Intronic
1076839863 10:133040632-133040654 GGCTGTGGGCGGGGCAGGGGCGG + Intergenic
1076916381 10:133424704-133424726 GGCTGGTGACGGAGGACGGGAGG - Intergenic
1076936488 10:133569499-133569521 GGCTGGTGACGGAGGACGGGAGG - Intronic
1077093579 11:790123-790145 TGCTCCCGGCGCAGGAGGGCGGG + Exonic
1077095220 11:796252-796274 AGCTGCCGGGGGAGGAGGCGAGG + Exonic
1077136229 11:1000497-1000519 CGCTGCCGCCGGAGGAGGGTGGG - Exonic
1077159862 11:1107787-1107809 GGCTGCCGCCCGGGGTGGGGTGG + Intergenic
1077220451 11:1413311-1413333 GGCTGCAGGGGTGGGAGGGGTGG - Intronic
1077307526 11:1874737-1874759 GGCTGCAGACGGAGGAGTGGAGG + Intronic
1077309698 11:1882897-1882919 GGCTGCCGGCTGCGGGGGAGGGG - Intronic
1077441361 11:2570669-2570691 GGCAGCCGGCGGACCAGAGGCGG - Exonic
1077538667 11:3136229-3136251 GGCAGCTGGCGGAGGCAGGGGGG - Intronic
1078399512 11:11011524-11011546 GGCTGACGGAGGAGGGGTGGTGG + Intergenic
1080496954 11:32829918-32829940 GGCGGCCGACGGAGGACGGGAGG - Intergenic
1080779961 11:35420177-35420199 GGGTGCCGGCTGAGAAGGCGCGG + Intergenic
1081576990 11:44324982-44325004 GGCTGGAGGAGGAGGAGGCGCGG + Intergenic
1081593600 11:44444213-44444235 GGCAGCCGTGGGAGGCGGGGAGG + Intergenic
1081747901 11:45485896-45485918 GGCTGCTGGAGGTGGAGGAGGGG - Intergenic
1081831479 11:46119892-46119914 GGGCGCGGGCGGGGGAGGGGCGG + Intronic
1083282550 11:61636037-61636059 GGCTGTCCCTGGAGGAGGGGAGG + Intergenic
1083463711 11:62831953-62831975 GGCGGCAGGCGGCAGAGGGGAGG - Exonic
1083721613 11:64606451-64606473 AGCTGCTGGAGGAGCAGGGGTGG - Exonic
1083849149 11:65355138-65355160 GGCTGCGGGCAGCGGAGGGGCGG - Intronic
1083931615 11:65849461-65849483 GGAAGGCTGCGGAGGAGGGGAGG - Exonic
1084092231 11:66886207-66886229 GGGGGCAGGCAGAGGAGGGGAGG + Intronic
1084426703 11:69087960-69087982 GGCTGCCGTCCCAGCAGGGGCGG + Exonic
1084529291 11:69717554-69717576 GGCGGGAGGAGGAGGAGGGGAGG - Intergenic
1085046905 11:73358977-73358999 GGCAGCCTGCTGAGGAGGGGAGG - Intronic
1085274899 11:75292084-75292106 GGCTCCCAGGGGAGGTGGGGCGG - Intronic
1085416496 11:76322047-76322069 GGCTGCCGGCGGGGCAGGCGGGG + Intergenic
1086949553 11:92877515-92877537 GGGTGGTGGCAGAGGAGGGGTGG - Intronic
1088223230 11:107591226-107591248 GGCTGCGGGCGCGGAAGGGGCGG - Exonic
1088847277 11:113679340-113679362 GGCTGCGTGAGGAGGAGGGGAGG - Intergenic
1089442919 11:118531294-118531316 GGATGTCGGCGGAAGAGGAGAGG - Intronic
1089499285 11:118923111-118923133 AGCTGCCGGGGCAGGAGTGGAGG - Intronic
1089624035 11:119740080-119740102 GGCTGCCAGGGCTGGAGGGGTGG + Intergenic
1090003634 11:122981911-122981933 GGCTGCCAGAGGCAGAGGGGAGG + Intergenic
1090071044 11:123545054-123545076 GGCTGCCTTCAGAGGAGGGGAGG - Intronic
1090189348 11:124758460-124758482 GGTTGCAGGCGGTGGAGGGAGGG - Exonic
1090190483 11:124763115-124763137 TGCTGACTGGGGAGGAGGGGCGG + Intergenic
1090616769 11:128522270-128522292 GGCAGCCGCCGGCGGAGAGGAGG - Intronic
1091225740 11:133955897-133955919 GGGCGGCGGCGGGGGAGGGGAGG - Intronic
1091259517 11:134223762-134223784 GGGTGCCGGTGGGGGCGGGGTGG - Intronic
1091390937 12:125743-125765 AGCTGCAGGAGGAGGAGGAGCGG + Exonic
1091616122 12:2052686-2052708 GGCCGCCGGCGGGCGAGGGGCGG - Intronic
1092001759 12:5038626-5038648 GCCTGCCCGTGGAGGAGGGAAGG + Intergenic
1092054217 12:5495783-5495805 GGCTGGCAGATGAGGAGGGGTGG - Intronic
1092259314 12:6944246-6944268 GGATGCGGGCGGAGGATGTGGGG + Intronic
1093583232 12:20807507-20807529 GGCGGCGGGGGGAGGAGGGGCGG + Intergenic
1093958855 12:25251118-25251140 GGCCGGCGGGGGAGGAGCGGGGG + Intergenic
1094493816 12:30977283-30977305 GGGTGGCGGCGGAGCGGGGGCGG - Intronic
1094800043 12:34022662-34022684 GGCTGAAGGCGGAGAAGAGGAGG - Exonic
1095112834 12:38316956-38316978 GGCTGAAGGCGGAGAAGAGGAGG - Exonic
1095954168 12:47797034-47797056 GGCCGCCGCCGGAGGCTGGGGGG + Exonic
1096077642 12:48815146-48815168 AGCCGCCGCCGGAGGATGGGCGG + Intronic
1096518684 12:52172150-52172172 GGCTGCAGGGGAAGGAGGGCTGG - Intronic
1096693248 12:53333766-53333788 GGCTTCCTGGGGAGGTGGGGAGG + Intronic
1096710513 12:53452244-53452266 GGCGGGCGGAGGAGGAAGGGGGG - Exonic
1096717361 12:53499516-53499538 GGCAGCGGGGGGAGGAGGGAAGG - Intronic
1096781139 12:53992789-53992811 GCCTGCGGGCGGAGTTGGGGGGG + Intronic
1097107701 12:56635037-56635059 GGCCGGCGGCGGCGGAGGGGAGG + Intronic
1097225985 12:57477018-57477040 GGCTGAAGGAGGAAGAGGGGTGG + Intronic
1097263932 12:57735491-57735513 AGCTGCAGAGGGAGGAGGGGTGG - Intronic
1097794116 12:63844243-63844265 GTCTGCGGGCAGAGGAGCGGCGG + Intergenic
1097925377 12:65121377-65121399 GGACGCGGGAGGAGGAGGGGGGG + Exonic
1098416835 12:70243684-70243706 GGGTGGCGGCGGTGGAGGGAGGG + Intronic
1098595967 12:72273146-72273168 AGCCGCCGTCGGAGGAGGAGCGG + Exonic
1098649873 12:72951924-72951946 AGCAGCCGGTGGAGGAGAGGGGG - Intergenic
1099413382 12:82358919-82358941 GCGTGGCGGCGGAGGCGGGGCGG + Intronic
1099413459 12:82359373-82359395 GGCTGCAGGTGCAGGACGGGAGG + Intronic
1102381288 12:112468826-112468848 GGCTGAGGCCGGAGGAGGGCTGG + Intronic
1102637350 12:114335854-114335876 GACTGAGGGTGGAGGAGGGGAGG - Intergenic
1102677415 12:114668114-114668136 GGCTGGGGACGGAGGAGGAGGGG + Intergenic
1102853993 12:116277628-116277650 GGCTGACTGGGGAGGAGGGGGGG - Intergenic
1102880943 12:116484312-116484334 GGAAGCCGGGGGAGGGGGGGCGG + Intergenic
1103052416 12:117791651-117791673 GGCTGCTGGAGGAGGTGGGAGGG + Intronic
1103444368 12:120984537-120984559 GGCTGCAGATGGGGGAGGGGAGG + Intronic
1103720096 12:122969175-122969197 GGCAGCCGGGGGGGGGGGGGGGG - Intronic
1103742779 12:123102566-123102588 GGCTGCCTGTGGGGGATGGGAGG - Intronic
1103893766 12:124259740-124259762 GGCAGGCGGCCGGGGAGGGGCGG - Intronic
1104270418 12:127278200-127278222 GGCTTCCAGGGGAGGAGCGGTGG + Intergenic
1104276711 12:127335397-127335419 GGCTTCCAGGGGAGGAGGGAAGG + Intergenic
1104597996 12:130132982-130133004 GGCTGGAGGCAGAGGAGGAGAGG + Intergenic
1104843286 12:131834632-131834654 GCCTGGCGGGAGAGGAGGGGTGG + Intronic
1105472027 13:20703594-20703616 CGCTGGCGGCGGAGCAGGGATGG + Intronic
1105474850 13:20720877-20720899 GTCTGCCGGGGGAGGGGGGGGGG - Intronic
1105512244 13:21060987-21061009 GGATCCCGGCGGGGCAGGGGCGG - Intronic
1105623015 13:22087423-22087445 GGCTGTCAGCGGAAGAGGAGAGG - Intergenic
1106087684 13:26557888-26557910 GGCGGCTGTCGGGGGAGGGGCGG + Intronic
1106101068 13:26695504-26695526 GCCTGCTGGAGGAGGAGGGAGGG - Intergenic
1106108967 13:26760540-26760562 GGCGGCCCGCGGGGGCGGGGGGG + Intronic
1106157464 13:27171675-27171697 GGCGGCGGGCGGGGGAGGAGGGG + Exonic
1106956403 13:34942889-34942911 GGCCGCTGGCGGAGGCGGCGGGG + Exonic
1107614516 13:42151007-42151029 GGCTGCAAGCGGAGGAAGGTAGG + Intronic
1109197146 13:59390686-59390708 GGCTGCGTGGGGAGGAGGTGAGG - Intergenic
1109553293 13:63935359-63935381 GGGTGTGGGCGGACGAGGGGAGG - Intergenic
1110219583 13:73059219-73059241 GGCTGCCGGCGGAGGAGGGGAGG - Exonic
1111940461 13:94601841-94601863 GGCAGCTGGGGGAGGCGGGGTGG - Intergenic
1113479986 13:110613818-110613840 GGCTGGCGGGGGTGGGGGGGTGG - Intergenic
1113647688 13:112010873-112010895 GGGTATCGGCGGAGCAGGGGTGG - Intergenic
1113711333 13:112467275-112467297 GGCTCCTGGGGGAGGAGGTGCGG - Intergenic
1113798931 13:113076680-113076702 GTCTGCCAGCGGAGGCGGGATGG - Intronic
1113841564 13:113364180-113364202 GGCTGGAGGCGGGGGCGGGGGGG + Intergenic
1113944692 13:114037478-114037500 GGCTGCCGGTGGGGAAGGGGCGG + Intronic
1114558633 14:23576455-23576477 GCCTGCGGGCGGCGGAGGGGTGG + Exonic
1114633017 14:24171784-24171806 GGCTTGCGGCGGGGGAGCGGCGG + Intergenic
1117394791 14:55298574-55298596 GGGTGGAGGCGGAGGAGGGCGGG + Intronic
1118646556 14:67846420-67846442 GGGTGCCAGCGATGGAGGGGAGG + Intronic
1119248995 14:73136391-73136413 GCCGGCCCACGGAGGAGGGGAGG - Intergenic
1119682251 14:76601591-76601613 GGCTGGAGGAGGAGGAGCGGAGG + Intergenic
1121337446 14:93085984-93086006 GGCTGACGGAGGAGGGGGAGTGG - Intronic
1121495571 14:94389558-94389580 GACTGCTGGGGGTGGAGGGGAGG + Intronic
1122077502 14:99245771-99245793 GGCGACTGGTGGAGGAGGGGCGG + Intronic
1122183413 14:99971743-99971765 GGCCGCCGCCGGGGGATGGGGGG - Intronic
1122407313 14:101508287-101508309 GGCTGCTGCCAGAAGAGGGGTGG - Intergenic
1122611874 14:102990031-102990053 GGTTGCCAGCGGAGGTGGGCAGG + Intronic
1122775187 14:104113859-104113881 GGCTGCAGGTGGAGGGAGGGTGG + Exonic
1122799685 14:104223372-104223394 GGCTGCCTGCAGAGGCGGGAGGG - Intergenic
1122847291 14:104506849-104506871 GGCTGCCCACGGTGGAGGAGAGG - Intronic
1122886637 14:104713259-104713281 AGCTGGCGGAGGAGGAGGCGCGG + Exonic
1122959414 14:105087653-105087675 GGCCGCTGGCGGAGCAGCGGCGG + Intergenic
1122967898 14:105139783-105139805 GGCTGTTGGAGGTGGAGGGGTGG - Intergenic
1122978561 14:105181086-105181108 GGCCGCCGGCGGGGGCGCGGGGG + Intronic
1202928983 14_KI270725v1_random:22761-22783 GGCTGCAGACAGAGGAGTGGAGG - Intergenic
1123423249 15:20148271-20148293 GGCGGACAGCGGCGGAGGGGCGG + Intergenic
1123532476 15:21154810-21154832 GGCGGACAGCGGCGGAGGGGCGG + Intergenic
1123691960 15:22845678-22845700 GGTTGCAGGAGGAGGAGGAGGGG + Intronic
1124223300 15:27868547-27868569 GGCTGTCGGGGGTGGAGGGAGGG + Intronic
1124410499 15:29432749-29432771 GGGAGCTGGGGGAGGAGGGGAGG - Intronic
1125535759 15:40440730-40440752 GGCGGCCGGGGGAGGCGGTGCGG - Intronic
1125722866 15:41853478-41853500 GGCTGGCTGGGGAGCAGGGGAGG + Intronic
1125728866 15:41881966-41881988 GGCGGCTGGAGGAGCAGGGGCGG - Exonic
1126049450 15:44673178-44673200 AGGTGCTGGCTGAGGAGGGGCGG - Intronic
1126167674 15:45667144-45667166 GGCTGAAGGGAGAGGAGGGGAGG - Intronic
1127994786 15:64147182-64147204 GGCGGGCGGCAGCGGAGGGGTGG - Intergenic
1128144701 15:65326450-65326472 CGCTGCTGGCCGAGGAGGGGTGG + Intergenic
1128259170 15:66220460-66220482 GGTTGCCAGGGGAGGAGGAGAGG + Intronic
1128286971 15:66445142-66445164 GGCAGCGGGGGGAGGTGGGGGGG + Intronic
1128766579 15:70254799-70254821 TGCGGCCGGGGGAGGCGGGGAGG - Intergenic
1128766580 15:70254802-70254824 GGCTGCGGCCGGGGGAGGCGGGG - Intergenic
1129029748 15:72609618-72609640 GGCTGCGGGAGCAGGAGGAGAGG + Intergenic
1129029774 15:72609756-72609778 GGCTGCTGGAGCAGGAGGAGAGG + Intergenic
1129190031 15:73931739-73931761 GGCAGCCTGTGGAGGTGGGGTGG - Intronic
1129206357 15:74039144-74039166 TGGTGACGGCGGAGGAAGGGAGG + Intronic
1129251656 15:74312540-74312562 GGCTGATGGCTCAGGAGGGGTGG - Intronic
1129561573 15:76576683-76576705 GGCTGCCAGGGTAGGAGGGAGGG - Intronic
1130146180 15:81275344-81275366 AGTTGACGGGGGAGGAGGGGGGG + Intronic
1130484669 15:84392080-84392102 GGCTGCAGGAACAGGAGGGGTGG + Intergenic
1130613346 15:85380894-85380916 GGCGGGCCCCGGAGGAGGGGCGG + Intronic
1131197095 15:90364331-90364353 GGCTGGCGGGGGAGTGGGGGGGG - Intronic
1131367845 15:91854334-91854356 GGGTGCCGGGGGAGGAGAGGCGG + Intronic
1131827375 15:96332047-96332069 GGCTGCGGGCGGCGGCGGGGCGG - Exonic
1132145992 15:99430306-99430328 GGCTGCGGGAGGAGCAGGGGAGG - Intergenic
1132500875 16:284164-284186 GGCTGTGGGGGGAGGGGGGGTGG + Intronic
1132632363 16:924985-925007 GGCAGCGGGGGGTGGAGGGGAGG + Intronic
1132640842 16:977648-977670 GCCTGCCGCAGGAGGAGGGCCGG + Intronic
1132694962 16:1197994-1198016 GGCTGCTGGAGGCGGTGGGGAGG - Intronic
1132722036 16:1321224-1321246 CGCTGCAGGCGGAGCAGTGGGGG - Intronic
1132740816 16:1412106-1412128 GGCTGCTGGCGGAGGGTGGAGGG - Intronic
1132851246 16:2026001-2026023 GGCTGTGGGCAGGGGAGGGGAGG + Intronic
1132934389 16:2473555-2473577 GGAAGCTGGCGGAGGAGGGAAGG - Intronic
1132934582 16:2474219-2474241 AGCTGCCGGCGGGGACGGGGCGG - Intergenic
1132951511 16:2564976-2564998 GGGGGCCGGCGGAGCAGGGTCGG - Intronic
1132962839 16:2635194-2635216 GGGGGCCGGCGGAGCAGGGTCGG + Intergenic
1133147823 16:3803251-3803273 GGCTGACGGCGGGGAGGGGGGGG + Intronic
1133727674 16:8552824-8552846 GGCTGCTGGGAGGGGAGGGGAGG - Intergenic
1133828853 16:9303139-9303161 GGGTGGCGGGGGAGGAGGTGGGG + Intergenic
1134121465 16:11587223-11587245 GGCTGTCGGGGGCGGACGGGTGG - Intronic
1134134185 16:11668657-11668679 GTCTGCGGGCGGGGGAGGGGCGG + Intronic
1134402184 16:13920356-13920378 CGCAGCCGGCCGAGGAGGTGCGG + Exonic
1134452601 16:14372657-14372679 GCCTGCAGGCAGGGGAGGGGAGG - Intergenic
1134588654 16:15434510-15434532 CGCTGGCGGCGGCGGAGGAGAGG + Exonic
1134696988 16:16232538-16232560 GGCTGGCGGCGGCGGTGGGGCGG + Exonic
1135039371 16:19106162-19106184 GGCTGGCAGCAGAGGTGGGGTGG - Intergenic
1135607353 16:23836096-23836118 GGCTGCGGGCCGGGGAGGCGCGG - Exonic
1136069576 16:27779651-27779673 GGCTGAAGGGGGAGAAGGGGTGG - Exonic
1136111025 16:28063633-28063655 GGCGGGCGGCGGTGGAGGAGCGG + Intergenic
1136145435 16:28313687-28313709 GGCTGCAGGGCGGGGAGGGGAGG + Intronic
1136342990 16:29657005-29657027 GGCTCCAAGCAGAGGAGGGGTGG + Intergenic
1136414778 16:30096350-30096372 AGCGGGCGGCGGGGGAGGGGCGG - Intronic
1136861441 16:33706865-33706887 GGCTGCAGACAGAGGAGTGGAGG - Intergenic
1137426454 16:48385003-48385025 GGCTGAAGGCAGGGGAGGGGCGG + Intronic
1137454713 16:48609687-48609709 GGCGGACGGCGGGGGCGGGGAGG + Intronic
1138663518 16:58542062-58542084 GGCTGCCTGTGGAGGAGGTATGG - Intronic
1138889843 16:61128837-61128859 GGGAGCCGGTGGGGGAGGGGCGG + Intergenic
1139547001 16:67654070-67654092 GGCTGCCGGCCGGGGGGGGGGGG + Intronic
1140223109 16:73058189-73058211 GGCGGCCGGCGGCGGCGGCGCGG + Intronic
1140908188 16:79428208-79428230 AGCTGCAGGTGGAGGAGGTGAGG - Intergenic
1141676826 16:85522175-85522197 GGCTGTGGGAGGAGGAGAGGAGG - Intergenic
1141830042 16:86505508-86505530 GGCTGCCGGAGGAGCGCGGGAGG - Intergenic
1141959156 16:87392720-87392742 GGCAGCCGGCGGAGGGCGGGCGG + Intronic
1142026962 16:87819620-87819642 GCCTGGCGGCGGTGGGGGGGGGG + Intergenic
1142114946 16:88351689-88351711 TGCTGCCGGCGGTGGGGGTGGGG - Intergenic
1142206433 16:88785218-88785240 GCCCGCGGGCGGAGGAGGGCGGG - Intergenic
1142209912 16:88804043-88804065 GGCTGTCGGTGGACGAGGTGAGG + Exonic
1142284981 16:89167977-89167999 GGCTGCTGGTGGGGGCGGGGTGG - Intergenic
1142362239 16:89632945-89632967 GGCTGCAGGAGGAGGAGGGAGGG + Intronic
1203122940 16_KI270728v1_random:1555056-1555078 GGCTGCAGACAGAGGAGTGGAGG - Intergenic
1142719550 17:1767032-1767054 TGCTGCCTGCCAAGGAGGGGCGG - Intronic
1142764167 17:2056443-2056465 AGCGGCCGCCGGTGGAGGGGAGG - Intronic
1142809212 17:2387396-2387418 GGCAGCCGGTGGGGGAGGAGGGG + Exonic
1143091166 17:4449843-4449865 GGCTGCCGGGAGGGGAGGCGCGG + Intronic
1143118229 17:4592453-4592475 GGCTGACGGCAGAGGAGGGGTGG + Intronic
1143432265 17:6895658-6895680 GGCTGGCGGGGGGGGGGGGGGGG + Intronic
1144890561 17:18491716-18491738 GGCTGCCTGCGGAGGGGCTGAGG + Intronic
1144950937 17:18993041-18993063 AGGTGCCTGGGGAGGAGGGGTGG + Intronic
1145141657 17:20452602-20452624 GGCTGCCTGCGGAGGGGCTGAGG - Intronic
1145794251 17:27646315-27646337 GGCTGCCTGCGGAGGGGTTGAGG + Intronic
1145900835 17:28489495-28489517 GGCTGCGGGCTGGGGTGGGGAGG + Intronic
1147159517 17:38562133-38562155 GGCTGCCGGCGTACGAAGGCGGG + Exonic
1147217670 17:38910452-38910474 GGCAGGGGGCGGTGGAGGGGGGG - Intronic
1147264376 17:39225875-39225897 TGGGGCCGGCGGGGGAGGGGAGG - Intergenic
1147710320 17:42458837-42458859 GGCCGGCGGCGGCGCAGGGGCGG + Intronic
1148262012 17:46192782-46192804 GGCAGCAGGAGGAGGAGGAGAGG + Exonic
1148461863 17:47843607-47843629 AGCTGCATGGGGAGGAGGGGTGG + Intergenic
1148562440 17:48613669-48613691 CGCGGTCGGCGGAGGAGGAGGGG + Intronic
1148724262 17:49777259-49777281 GGCTGCTGGAAGGGGAGGGGTGG + Intronic
1148754299 17:49964619-49964641 AGCTCCCGGGGGAGGAGGAGGGG - Intergenic
1148830297 17:50426506-50426528 GGCGGGGGGCGGGGGAGGGGCGG - Intronic
1148838891 17:50482212-50482234 GGCTGCCGGCACAGCAGGTGGGG + Exonic
1148852252 17:50560966-50560988 GCCAGGCGGCGGGGGAGGGGAGG - Intergenic
1148930104 17:51120801-51120823 GGCCGGGGCCGGAGGAGGGGAGG + Exonic
1148936230 17:51166405-51166427 GGGAGCCGGCGGCGGAGGAGGGG - Intronic
1150211282 17:63442947-63442969 GGCGGAAGGCGGAGCAGGGGAGG + Intronic
1151828624 17:76537329-76537351 GGCTCCGGGCAGAGGAGGGCTGG - Intronic
1151940286 17:77287698-77287720 TGTTGCTGGCAGAGGAGGGGCGG + Intronic
1152238769 17:79151419-79151441 ACCTGCAGGGGGAGGAGGGGAGG + Intronic
1152238785 17:79151457-79151479 ACCTGCAGGGGGAGGAGGGGAGG + Intronic
1152238801 17:79151495-79151517 ACCTGCAGGGGGAGGAGGGGAGG + Intronic
1152238816 17:79151530-79151552 ACCTGCAGGGGGAGGAGGGGAGG + Intronic
1152238831 17:79151565-79151587 ACCTGCAGGGGGAGGAGGGGAGG + Intronic
1152238847 17:79151603-79151625 ACCTGCAGGGGGAGGAGGGGAGG + Intronic
1152238862 17:79151638-79151660 ACCTGCAGGGGGAGGAGGGGAGG + Intronic
1152238879 17:79151676-79151698 ACCTGCAGGGGGAGGAGGGGAGG + Intronic
1152238894 17:79151711-79151733 ACCTGCAGGGGGAGGAGGGGAGG + Intronic
1152238909 17:79151746-79151768 ACCTGCAGGGGGAGGAGGGGAGG + Intronic
1152238939 17:79151819-79151841 ACCTGCAGGGGGAGGAGGGGAGG + Intronic
1152238956 17:79151857-79151879 ACCTGCAGGGGGAGGAGGGGAGG + Intronic
1152238971 17:79151892-79151914 ACCTGCAGGGGGAGGAGGGGAGG + Intronic
1152362346 17:79838707-79838729 GGAGGCCGGCGGAGGGAGGGAGG - Intronic
1152363166 17:79841666-79841688 GGCTGCCGGGGGAGGCCGAGCGG + Intergenic
1152364969 17:79850211-79850233 GGCTGAGGGCGGAGGAGGAGGGG + Intergenic
1152584156 17:81181700-81181722 GGCTGGCGGCCACGGAGGGGTGG + Intergenic
1152719226 17:81914736-81914758 GGCTGCCAGTGGTGGTGGGGAGG + Intronic
1152742226 17:82023358-82023380 GGCTGCAGGCGGGGCAGGGCTGG + Exonic
1152744774 17:82033613-82033635 GGCGGCCTGCAGGGGAGGGGTGG + Intronic
1153285666 18:3452218-3452240 GCGCGCCGGTGGAGGAGGGGGGG - Exonic
1153515234 18:5895633-5895655 GGCGGGCGGCGGAGGACGCGGGG - Intronic
1155075245 18:22348710-22348732 GGAAGGCGGCGGGGGAGGGGCGG + Intergenic
1156350371 18:36297487-36297509 GGCCGGCGGCGGAGGCGGGGCGG - Intergenic
1156472397 18:37385568-37385590 GGCTGGGGGAGGTGGAGGGGAGG - Intronic
1156502033 18:37566185-37566207 GGCCGCCGACGGGGGAGGCGCGG - Intergenic
1157516692 18:48316347-48316369 GGCTGGGGGTGGAGGAGGAGTGG - Intronic
1157610472 18:48952085-48952107 GGCTGGGGGCGGGGGAGGGAAGG - Intergenic
1157748883 18:50160875-50160897 GGCTGCTGGTGGCTGAGGGGTGG - Intronic
1157752589 18:50193275-50193297 GGCCTCTGGGGGAGGAGGGGAGG - Intronic
1157816964 18:50736500-50736522 GGCTGCCAGCTGGGGAGGGTGGG + Intergenic
1157862678 18:51154871-51154893 GGCTGGGGGCAGAGGAGGGAGGG - Intergenic
1158539435 18:58339392-58339414 CGCTGCTAGAGGAGGAGGGGAGG + Intronic
1160024900 18:75209161-75209183 GGCGCCGGCCGGAGGAGGGGCGG - Exonic
1160045785 18:75386160-75386182 GGCTGCAGGTGGAGGGGTGGAGG + Intergenic
1160567077 18:79792840-79792862 GGCAGCGGGCGGAGGTCGGGAGG + Intergenic
1160690934 19:460500-460522 GGCTCCCGGGGGGGGTGGGGGGG + Intronic
1160700864 19:506724-506746 GGCTGCGGGCTGCGGAGGGTTGG + Intergenic
1160719086 19:589813-589835 GCCTCGCGGCGGGGGAGGGGCGG - Intergenic
1160751832 19:737993-738015 GGCTGCTGGGGGAGGAGGCTGGG + Intronic
1160768875 19:821650-821672 CGGCGCCGGCGGGGGAGGGGCGG + Intronic
1160864098 19:1249591-1249613 GGCTGCGGGCGCGGGCGGGGCGG + Intronic
1160880162 19:1316029-1316051 CGCTCCGGGCGCAGGAGGGGCGG + Intergenic
1161028845 19:2048772-2048794 GGCTGCTGGGGGAGGAGGGAAGG + Intronic
1161076837 19:2289952-2289974 GCCGGCCCGCGGGGGAGGGGAGG + Exonic
1161210668 19:3063562-3063584 GGCTGTGGGAGGAGGAGGGACGG + Intergenic
1161243305 19:3234957-3234979 GGCTGCAGGCAGAGGAGGGACGG - Intronic
1161257337 19:3316617-3316639 GGCTGCGGGCAGAGGAGGGACGG + Intergenic
1161262448 19:3345392-3345414 GGCTGCGGGCAGAGGAGGGATGG - Intergenic
1161270714 19:3387929-3387951 GGCTGCCAGAGGGGGCGGGGAGG - Intronic
1161288978 19:3482908-3482930 GGACGCCGGCGGGGGTGGGGAGG - Intergenic
1161289438 19:3485131-3485153 GGCTGTGGGCAGAGGAGGGATGG + Intergenic
1161331950 19:3692718-3692740 GGCTGCGGGCAGAGGAGGGATGG - Intronic
1161332924 19:3696841-3696863 GGCTGCGAGCAGAGGAGGGTCGG + Intronic
1161428560 19:4217628-4217650 TGCTGGCGGAGGAGGAGGCGCGG + Exonic
1161435096 19:4258366-4258388 GCCTGTCGGAGGAGGAGCGGCGG + Exonic
1161581730 19:5084849-5084871 GGCGGCGGGCGGGGGAGGGTGGG - Intronic
1161621388 19:5299152-5299174 GGCTGTGGGCAGAGGAGGGACGG - Intronic
1161649380 19:5474892-5474914 GGCTGTAGGCAGAGGAGGGACGG + Intergenic
1161664178 19:5565026-5565048 GGCTGTGGGCAGAGGAGGGACGG - Intergenic
1161746925 19:6066102-6066124 GCTTGCCAGCGGAGGAGGTGGGG + Intronic
1161815657 19:6498439-6498461 GGCTGTAGGCAGAGGAGGGACGG - Intronic
1161964405 19:7540328-7540350 GGCTGCTGCAGGAGGATGGGTGG + Intronic
1161978615 19:7619426-7619448 GGCTGCTGTGGGAGGTGGGGCGG - Intergenic
1162105384 19:8366871-8366893 GGGGGCCGGCGGGGGCGGGGAGG - Intronic
1162142357 19:8592376-8592398 GGCTTCAGGCTGGGGAGGGGAGG + Intronic
1162440271 19:10688207-10688229 TGCTGCTGGCTGAGGAGAGGCGG + Intronic
1162506919 19:11090881-11090903 GGCTGCAGACCAAGGAGGGGCGG - Intronic
1163674687 19:18649671-18649693 GGCTACCAGAGGAGGAGGGCGGG - Intronic
1163729568 19:18941262-18941284 GGCGGCCCGGGGAGGCGGGGCGG - Intergenic
1163774157 19:19208239-19208261 TGCTGCCAGTGGGGGAGGGGTGG - Intergenic
1164137653 19:22428388-22428410 ACCAGCGGGCGGAGGAGGGGCGG - Intronic
1164179632 19:22807462-22807484 ACCAGCGGGCGGAGGAGGGGCGG - Intergenic
1164457731 19:28422385-28422407 TGGTGACGGGGGAGGAGGGGAGG + Intergenic
1164643561 19:29843270-29843292 GACTGGCGGCGGAGGAGGCCTGG - Intergenic
1165013217 19:32863660-32863682 GGCTGGTGGGGGAGTAGGGGTGG - Intronic
1165130963 19:33631765-33631787 GGCTGCCTGGGGTGGAGGGAGGG - Intronic
1165256055 19:34577804-34577826 GGCTGGGGGCGGGGCAGGGGCGG - Intergenic
1165419929 19:35717712-35717734 GGCTGCCGGCGGAAGAAGCGAGG + Intergenic
1165476275 19:36032686-36032708 GGCGGCCCGCGGAGAAGGGGAGG - Intronic
1165876534 19:39011684-39011706 AGATGGCGGCGGGGGAGGGGGGG + Intronic
1166043935 19:40218453-40218475 GGCTGCCGGAGGTGAGGGGGCGG - Intergenic
1166091577 19:40512793-40512815 GGCTGCGGGCGGCGGCGGTGCGG + Exonic
1166563311 19:43747736-43747758 GGCTGCAGGGGGTGGTGGGGCGG + Exonic
1166721796 19:45001416-45001438 GGCGGCGGGCGGGGGCGGGGCGG - Exonic
1166843230 19:45711623-45711645 GGCTCCCGGGGGGAGAGGGGAGG + Exonic
1167074303 19:47239675-47239697 GGCTGGCCGGGAAGGAGGGGGGG - Intergenic
1167104219 19:47420780-47420802 GGATGCCGGCGGGGGACGGAGGG + Intergenic
1167472699 19:49684434-49684456 GGCAGCAGGAGGAGGAGTGGAGG + Intronic
1167473358 19:49687251-49687273 GGCTTCCGGGGGAGCTGGGGGGG + Intronic
1167708182 19:51094157-51094179 GTCTGCCAGCGGAGGCGGGCAGG - Intergenic
1168267033 19:55228784-55228806 GGCTTCAGGGGGTGGAGGGGAGG + Exonic
1168340741 19:55621790-55621812 GGGACCCTGCGGAGGAGGGGCGG - Exonic
1168343646 19:55640458-55640480 GGCTGCATGCGCAGGTGGGGAGG - Intronic
1168466728 19:56608286-56608308 AGCTGCCAGGGGCGGAGGGGAGG - Intronic
1202693080 1_KI270712v1_random:105002-105024 GGCGGCCGGCGGCGGAGAGGCGG + Intergenic
1202693104 1_KI270712v1_random:105089-105111 GGCGGCCGGCGGCGGCGCGGCGG + Intergenic
1202693116 1_KI270712v1_random:105133-105155 GGCGGCCGGCGGCGGCGCGGCGG + Intergenic
1202693128 1_KI270712v1_random:105177-105199 GGCGGCCGGCGGCGGCGCGGCGG + Intergenic
1202693140 1_KI270712v1_random:105221-105243 GGCGGCCGGCGGCGGCGCGGCGG + Intergenic
1202693152 1_KI270712v1_random:105265-105287 GGCGGCCGGCGGCGGCGCGGCGG + Intergenic
1202693164 1_KI270712v1_random:105309-105331 GGCGGCCGGCGGCGGCGCGGCGG + Intergenic
1202693176 1_KI270712v1_random:105353-105375 GGCGGCCGGCGGCGGCGCGGCGG + Intergenic
1202693188 1_KI270712v1_random:105397-105419 GGCGGCCGGCGGCGGCGCGGCGG + Intergenic
1202693200 1_KI270712v1_random:105441-105463 GGCGGCCGGCGGCGGCGCGGCGG + Intergenic
1202693211 1_KI270712v1_random:105485-105507 GGCGGCCGGCGGCGGCGCGGCGG + Intergenic
1202693223 1_KI270712v1_random:105529-105551 GGCGGCCGGCGGCGGCGCGGCGG + Intergenic
1202693233 1_KI270712v1_random:105573-105595 GGCGGCCGGCGTCGGAGAGGCGG + Intergenic
1202693406 1_KI270712v1_random:106215-106237 GGCTGCAGACAGAGGAGTGGAGG + Intergenic
925181428 2:1819541-1819563 GGCTGCAGGAGGAGGAGTGGAGG - Intronic
925313773 2:2906715-2906737 GGCTGCGGGCTGGGGAGAGGGGG - Intergenic
925492743 2:4413038-4413060 GGCTGCCGCAGGGGGAGAGGAGG - Intergenic
925984525 2:9205939-9205961 GGGTGCAGGAGGAGGAGGAGGGG - Intergenic
925984795 2:9206931-9206953 GCCTGGCGGCGGAGCAGGGGCGG - Exonic
926077425 2:9952102-9952124 ACCTGGCCGCGGAGGAGGGGAGG - Intronic
926128644 2:10286713-10286735 GGCTCCCGTCGGGGGCGGGGGGG - Intergenic
926159111 2:10475454-10475476 GGCTGGCCACGGGGGAGGGGGGG + Intergenic
926562377 2:14432006-14432028 GGCAGCTGGGGGTGGAGGGGAGG + Intergenic
926733041 2:16051511-16051533 GGCTGCTGAGGGAGGAGAGGTGG + Intergenic
927708438 2:25311119-25311141 GGCTGGGGGCGGGGGCGGGGAGG + Intronic
927714545 2:25343089-25343111 GGCTGGAGGCGGGGGTGGGGGGG - Intergenic
928198796 2:29233588-29233610 GGCAGGAGGCGGAGGAGGAGGGG - Exonic
929011223 2:37447259-37447281 GGCGGCGGGCGGTGGCGGGGGGG + Intergenic
929126600 2:38528220-38528242 GGCGGCCGGCGGGGGAGGAGGGG - Intergenic
929311243 2:40428522-40428544 GACTGCCAGAGGTGGAGGGGAGG - Exonic
929966862 2:46542885-46542907 GGCTCCCCTCGCAGGAGGGGAGG - Exonic
931057968 2:58494091-58494113 TGCTGGGGGCGGAGTAGGGGCGG + Intergenic
932609075 2:73185310-73185332 GGCTGCCGGAGGAGCAGGATGGG + Intergenic
932772528 2:74508344-74508366 AGATGCCGAAGGAGGAGGGGAGG + Exonic
932812010 2:74833918-74833940 GGCGGGGGGCGGGGGAGGGGCGG - Intergenic
933783067 2:85815097-85815119 GGCTGCGGGTTGGGGAGGGGAGG - Intergenic
933794604 2:85909503-85909525 GGCTGCCCGAGGAGGAGGAAGGG - Intergenic
933953163 2:87348344-87348366 GGCTGCAGACAGAGGAGTGGAGG - Intergenic
933953359 2:87349136-87349158 GGCGGACGGCGGCGGAGAGGCGG - Intergenic
934031880 2:88055666-88055688 GGCTGGCGGCGTTGGCGGGGCGG - Exonic
934067089 2:88350552-88350574 GGCGGCCACCGGGGGAGGGGAGG - Intergenic
934177024 2:89585233-89585255 GGCTGCAGACGGAGGAGTGGAGG - Intergenic
934237393 2:90244689-90244711 GGCTGCAGACAGAGGAGTGGAGG - Intergenic
934237537 2:90245235-90245257 GGCGGCCAGCGGCGGAGAGGCGG - Intergenic
934237564 2:90245367-90245389 GGCGGCCAGCGGCGGAGAGGCGG - Intergenic
934237569 2:90245385-90245407 GGCGGCCAGCGGCGGAGAGGCGG - Intergenic
934275673 2:91571529-91571551 GGCGGCCAGCGGCGGAGAGGCGG + Intergenic
934287332 2:91659592-91659614 GGCTGCAGACGGAGGAGTGGAGG - Intergenic
934459823 2:94207994-94208016 GGCTGCAGACAGAGGAGTGGAGG - Intergenic
934460004 2:94208731-94208753 GGCGGCCAGCGGCGGAGAGGCGG - Intergenic
934475648 2:94591670-94591692 GGCTGGCCACGGAGGAGTGGAGG - Intronic
934993179 2:98935848-98935870 GGCACCGGGCGGAGGTGGGGCGG - Intronic
935196343 2:100819229-100819251 GGAGGGCAGCGGAGGAGGGGAGG + Intergenic
935593529 2:104862556-104862578 GGCTGGGCGCGGAGGTGGGGCGG + Intergenic
936500488 2:113062432-113062454 GGCTGCCGGCAGAGGAGGGGAGG - Exonic
937062258 2:118989463-118989485 TGCTGCCTGGGGAGGAGGGCTGG - Intronic
937206858 2:120242246-120242268 GGCTGGGGGCAGAGGAGGGAAGG + Intronic
937261168 2:120587456-120587478 GGCTGGCGGCGGCGAAGTGGCGG - Intergenic
937306889 2:120877135-120877157 ACCTGCTGGAGGAGGAGGGGAGG - Intronic
937346529 2:121129621-121129643 AGCTGGTGGCGGCGGAGGGGCGG - Intergenic
938074128 2:128322863-128322885 CGCTGCCCGGGGAGGAGGGTGGG - Intergenic
938211143 2:129466561-129466583 TGGCGCCGGCAGAGGAGGGGAGG + Intergenic
938578348 2:132623931-132623953 GGCTGCTGGTGGAGGTGAGGGGG - Intronic
938745685 2:134276156-134276178 GGCGGGCGGCGGGGGTGGGGGGG - Intronic
941038172 2:160590473-160590495 GGGTGAAGGGGGAGGAGGGGAGG - Intergenic
941110700 2:161416812-161416834 GGCTGCCGATGGAGAAGGCGGGG - Exonic
943773009 2:191739434-191739456 GGCTGGAGGAGGAGCAGGGGAGG - Intergenic
944695506 2:202196929-202196951 GGCTGGAGGCAGAGGAGAGGAGG + Exonic
944811084 2:203328253-203328275 GGCTCCCGGGGGCGGAGGGAAGG + Exonic
945088885 2:206160135-206160157 GGCTGCCGCGGGAGGGAGGGAGG + Intronic
945234834 2:207624841-207624863 AGCAGCCGATGGAGGAGGGGAGG - Intronic
945306824 2:208266544-208266566 GGCTGCCGGCTGAGCAAGGAAGG + Intronic
946183191 2:217961102-217961124 GGCTGCTGGGGGAGGATGGGAGG - Intronic
946310226 2:218879132-218879154 GGCTGCCGGCAGAGATGAGGGGG + Intergenic
946370646 2:219279502-219279524 GACTCCTGGCGGAGGAGGTGCGG + Exonic
947012682 2:225582965-225582987 GGCTGCGGCCGGAGGAGAAGAGG - Exonic
947591470 2:231388518-231388540 AGCTGCCAGCTCAGGAGGGGAGG + Intergenic
947635983 2:231681001-231681023 GGCAGGCGGCGGAGGCTGGGCGG + Intergenic
947800798 2:232927771-232927793 GGGGGCCCGCGGAGGAGGAGTGG + Intronic
948248174 2:236503845-236503867 GGCTGCAGGGCGAGGAGGTGGGG - Intronic
948548064 2:238746492-238746514 GGCTTCAGAGGGAGGAGGGGTGG - Intergenic
948563987 2:238871875-238871897 GGCTGCCGGGGGCCGAGGGGAGG + Intronic
948723567 2:239918579-239918601 GGCTGCCACTGCAGGAGGGGAGG - Intronic
948725219 2:239930173-239930195 GGCTGGTGGAGGAGCAGGGGCGG - Intronic
948725237 2:239930241-239930263 GGCTGGCGGAGGACTAGGGGCGG - Intronic
948932647 2:241141944-241141966 GGCTGCATGAGGAGCAGGGGTGG - Intronic
948947206 2:241226871-241226893 GGCTGGAGGAGGAGGAGGGAGGG - Intergenic
948995470 2:241576137-241576159 GGCTGCAGCGGGAGGAGGAGAGG - Intergenic
948995490 2:241576219-241576241 GGCTGCCAGGGGAGGGGTGGAGG - Intergenic
949051932 2:241902322-241902344 GGGAGGCGGCGGCGGAGGGGAGG - Intronic
949051939 2:241902339-241902361 GGGAGGCGGCGGCGGAGGGGAGG - Intronic
949051946 2:241902356-241902378 GGGAGGCGGCGGCGGAGGGGAGG - Intronic
949051953 2:241902373-241902395 GGGAGGCGGCGGCGGAGGGGAGG - Intronic
949051960 2:241902390-241902412 GGGAGGCGGCGGCGGAGGGGAGG - Intronic
949051967 2:241902407-241902429 GGGAGGCGGCGGCGGAGGGGAGG - Intronic
949055320 2:241924997-241925019 GGCTGACAGTGGAGGAGAGGTGG + Intergenic
1168755027 20:310391-310413 GGGGGCCGGCGGAGGAGGCGTGG - Intergenic
1168883566 20:1226624-1226646 GGGTGGCGGCGGTGGCGGGGAGG - Intronic
1168893426 20:1308533-1308555 GGCTCCAGGCGGTGGAGGTGCGG + Exonic
1169074424 20:2752305-2752327 CGGTGCCGGCCGGGGAGGGGCGG - Intronic
1169262495 20:4148894-4148916 GGCTGGCGGAGGAGGAGAGACGG + Exonic
1169832433 20:9839070-9839092 GGCGGCCGGGGGTGGAGGTGAGG + Intergenic
1169881430 20:10351332-10351354 CCCTGCCTGCTGAGGAGGGGAGG - Intergenic
1169893117 20:10474661-10474683 GGCGGCCGGCGGAAGTGGAGAGG - Intronic
1170950734 20:20933681-20933703 GGCAGCAGGCAGAGGAGGGGAGG + Intergenic
1171248477 20:23632061-23632083 GCCCGCCGGCTGCGGAGGGGAGG + Intronic
1171249704 20:23638256-23638278 GGGGGCCAGGGGAGGAGGGGAGG - Intronic
1172013843 20:31861662-31861684 AGCTGCCGGCGAAGCTGGGGTGG + Exonic
1172117476 20:32581481-32581503 GGCTGTGGGAGGAGGAAGGGAGG + Intronic
1172774053 20:37397112-37397134 GGCACCAGGCGGAGGTGGGGAGG - Intronic
1173294051 20:41739917-41739939 GGATGCCTGGGGAGGACGGGGGG + Intergenic
1173894683 20:46541807-46541829 GGCAGCGGGCGGAGGTGAGGCGG + Exonic
1173936721 20:46872759-46872781 TGCTTCCGGGGGTGGAGGGGCGG - Intergenic
1174494708 20:50931244-50931266 GGCGGCCGGGGGGGGGGGGGCGG + Intergenic
1174511669 20:51058092-51058114 GGCTGCCTGTGGGGGAGAGGGGG - Intergenic
1174898485 20:54475262-54475284 GGCTGAAGGGGGAGGCGGGGTGG + Intergenic
1175127158 20:56760906-56760928 AGCTGCCGAAGGAGGAAGGGAGG - Intergenic
1175217495 20:57399253-57399275 GGCTCCGAGCGGAGGAGGGATGG + Intronic
1175261203 20:57675327-57675349 GGCTGCCGGTGGAGGGGTCGGGG - Intronic
1175439287 20:58979613-58979635 GGCTGGGGGCGGGGGAAGGGGGG + Intergenic
1175464447 20:59180512-59180534 GGTTGCCGGGGGGGAAGGGGAGG - Intergenic
1175856282 20:62122554-62122576 GGCGGCGGGCGGAGGAGCGCAGG + Exonic
1175874306 20:62222153-62222175 GGATGACAGGGGAGGAGGGGTGG - Intergenic
1175941662 20:62540119-62540141 GGCTGGAGGAGGAGGAGGGTAGG + Intergenic
1175946332 20:62560750-62560772 GGTTGAGGGGGGAGGAGGGGAGG + Intronic
1175961022 20:62636412-62636434 GGAGGGCAGCGGAGGAGGGGAGG + Intergenic
1176039441 20:63056552-63056574 GGCTCCTGGCGGTCGAGGGGAGG - Intergenic
1176045116 20:63088522-63088544 GGCTGGCGGCGGTGGTGGTGAGG + Intergenic
1176246914 20:64101940-64101962 GGGTGCGGTCAGAGGAGGGGTGG - Intergenic
1176591004 21:8651348-8651370 GGCTGCAGACAGAGGAGTGGAGG - Intergenic
1178151938 21:29805136-29805158 GGCTGCAGGGGGTGGAGGGGTGG - Intronic
1179238321 21:39566630-39566652 GGCTGCAGCCGGGGGAGAGGGGG - Intronic
1179674286 21:42971543-42971565 AGCTGCCGGGGGAGGAAGGCAGG + Intergenic
1180127543 21:45802588-45802610 GGCTGACGGAGGAGGAGGACCGG + Intronic
1180273832 22:10628381-10628403 GGCTGCAGACAGAGGAGTGGAGG - Intergenic
1180285471 22:10741584-10741606 GGCTCCCGGAGCAGGAGGCGTGG + Intergenic
1180615011 22:17121056-17121078 GGCTGCCGGGGGCGGCGGGAAGG + Exonic
1180796750 22:18609572-18609594 GGCTGGCGGAGGAGAATGGGCGG - Exonic
1180949441 22:19714563-19714585 GGCCGCCGGCGGGGGACGTGCGG - Exonic
1181047106 22:20220357-20220379 GCCTGGTGGCGGGGGAGGGGGGG - Intergenic
1181111804 22:20606817-20606839 AGCGGCCTGCAGAGGAGGGGAGG + Intergenic
1181224974 22:21385699-21385721 GGCTGGCGGAGGAGAATGGGCGG + Exonic
1181253658 22:21549114-21549136 GGCTGGCGGAGGAGAATGGGCGG - Exonic
1181356118 22:22297404-22297426 GGCTGTGGGCGGTGGGGGGGTGG - Intergenic
1181556459 22:23674451-23674473 TGCTGCCTGGGGAGGCGGGGAGG - Intergenic
1181815894 22:25436581-25436603 GGCTGCCGGGGGAGGATGACAGG + Intergenic
1182355271 22:29719963-29719985 GGCGGCTGGCGGGGGAGGCGGGG + Intergenic
1182439818 22:30356699-30356721 GGCTGCAGGCTGAGGGGCGGGGG + Exonic
1182548283 22:31087912-31087934 GGCTGCCAGGGGCGGAGGGCTGG - Intronic
1182549639 22:31093837-31093859 TGGTGCCGGTGGAGGAGCGGCGG - Intronic
1182697317 22:32205972-32205994 CACTGCCTGCGGTGGAGGGGTGG + Intergenic
1183229934 22:36575492-36575514 GTCTGGCAGCGGAGGAGGGTGGG + Intronic
1183475290 22:38032836-38032858 GCCTGCAGGGGCAGGAGGGGTGG + Intronic
1183613515 22:38927307-38927329 GGCTGCCGGGGGCGGGGGGGGGG + Intergenic
1183702184 22:39457132-39457154 GGCTGGCGGGGGAGGGGAGGGGG + Intergenic
1183830330 22:40415506-40415528 GGCTTCAGGAGGAGGAGGAGCGG - Intronic
1184101551 22:42343884-42343906 GCGGGCGGGCGGAGGAGGGGCGG + Intergenic
1184236821 22:43187265-43187287 GGCGGGGGGCGGAGGCGGGGGGG - Intergenic
1184276482 22:43411954-43411976 GGCGGGCGGCGGAGGGGGCGCGG + Intronic
1184722317 22:46322184-46322206 GGGTGCAGGCGCAGGAGGGCGGG + Intronic
1184981933 22:48101196-48101218 GGATGTGGGCGGAGAAGGGGAGG + Intergenic
1185296755 22:50058430-50058452 GGCTGCTGTCGGAGCAGGCGCGG + Intergenic
1185333524 22:50261815-50261837 GGCCGCCGCCGGGGGAGGGCCGG + Exonic
1185393293 22:50574038-50574060 TGGAGCCGGCAGAGGAGGGGAGG - Intronic
1185409603 22:50674821-50674843 GGGTCCCGGCGGAGGCGGCGGGG - Intergenic
949105811 3:198178-198200 GGAGGCCGGCGGCGGAGGGCAGG + Intronic
950433968 3:12967665-12967687 AGCGGGCGGCGGCGGAGGGGCGG - Exonic
950523349 3:13509220-13509242 GGCTACCAGGTGAGGAGGGGAGG - Intergenic
950570387 3:13796191-13796213 GGCTGCCTGCTGTGGAGGGCTGG + Intergenic
950719751 3:14874542-14874564 GGTTGCCGGGGGTGGAGGGAGGG + Intronic
951225992 3:20122018-20122040 GGGTGCCGGTGGGGGCGGGGTGG + Intronic
951422969 3:22509813-22509835 TGCTGCAGGCGGATGAGGGTGGG - Intergenic
951485222 3:23202994-23203016 GCGCGCCGGAGGAGGAGGGGCGG + Intergenic
952241319 3:31533325-31533347 GGCCACGGGCGGGGGAGGGGCGG - Intronic
952287333 3:31981383-31981405 GGCCGCGGCGGGAGGAGGGGCGG - Intronic
952816578 3:37452360-37452382 GGCGGCCGGCTGGGGATGGGCGG + Exonic
952958447 3:38575242-38575264 GACGGCTGGAGGAGGAGGGGAGG - Intronic
953099274 3:39809523-39809545 GGGAGCCTGCGGAGGCGGGGCGG - Intronic
953099341 3:39809778-39809800 GGCTGCCGGCGGCGAAGAAGGGG - Exonic
953484959 3:43286552-43286574 GGCTGCCGGCCGCGGGGAGGGGG - Exonic
953801518 3:46027515-46027537 GGCTGGAGGAGGAGGATGGGAGG + Exonic
953988840 3:47467874-47467896 GCCTGCCGGGGGATGGGGGGAGG - Intronic
954090316 3:48278998-48279020 GGTTGCAGGGGAAGGAGGGGTGG + Intronic
955233774 3:57122323-57122345 GGCATCCGGTGGAGGATGGGAGG - Intronic
956084815 3:65597761-65597783 GGCAGGGGGCGGTGGAGGGGTGG + Intronic
956675572 3:71728981-71729003 GGCTGCAGATGGAGGAGAGGGGG + Intronic
958560771 3:95744846-95744868 GGCGGCTGGGGGAGGTGGGGGGG - Intergenic
960040900 3:113148968-113148990 GGCTGGTGGAGGAGGAGGGCAGG - Intergenic
960602132 3:119469011-119469033 GTCTGCCGGCGATGGAGTGGTGG + Exonic
960990801 3:123309933-123309955 GGCTGCAGGGAGAGGAGGAGAGG + Intronic
961234302 3:125351020-125351042 GGTTGCCAGGGGATGAGGGGAGG + Intronic
961434824 3:126909653-126909675 GGCAGCTGGAGGAGGAGGAGGGG + Intronic
961505816 3:127369964-127369986 GGCTGCCGGTGGGGGATGAGGGG + Intergenic
961754993 3:129122054-129122076 GGCTGAGGGCGGAGTCGGGGCGG - Intronic
961755014 3:129122134-129122156 GGCTGAAGGCGGAGTCGGGGAGG - Intronic
962236329 3:133710625-133710647 GGCTGCGGAGGGAGGAGGTGGGG - Intergenic
962498537 3:135966126-135966148 GGGCGCCCGCGGAGGAGGGTAGG + Intronic
962977675 3:140459792-140459814 AGCTGCTGGGGTAGGAGGGGTGG - Intronic
963847128 3:150170936-150170958 GGCAGTTGGCAGAGGAGGGGGGG - Intergenic
964376360 3:156052199-156052221 GGGTGGCGGGGGAGGAGGGTGGG - Intronic
964801785 3:160565537-160565559 TGCTGCCGGCTGAGAGGGGGAGG + Exonic
965757236 3:172039698-172039720 GGCTGCCGGCTGGGAAGGCGTGG + Intronic
966411836 3:179653094-179653116 GGCAGCCGGCCGAGCCGGGGCGG - Exonic
966904702 3:184513785-184513807 GGCTGCTGGCGAAGGAGGTCGGG - Intronic
967137687 3:186526376-186526398 GGCTGCCCGCAGCGGTGGGGGGG + Intergenic
968129612 3:196185114-196185136 GGCTGCAGGCGAAGGAGGTGAGG + Intergenic
968262078 3:197333575-197333597 GGCTGCTGGTGGTGGCGGGGAGG - Intergenic
968286125 3:197509967-197509989 AGCTGCCCCAGGAGGAGGGGGGG - Exonic
968456734 4:704196-704218 TGCTGCCCCCGGGGGAGGGGAGG - Intergenic
968456858 4:704686-704708 GGCTGGCGGCCCAGGACGGGAGG - Intergenic
968512963 4:1003365-1003387 GGCCGCCGGCGGGTAAGGGGCGG - Exonic
968556561 4:1248867-1248889 GGCCGCGGGCGGGGGCGGGGCGG - Intronic
968571991 4:1346886-1346908 GGCTGCCGGGGGTGGGGAGGGGG - Intergenic
968636631 4:1684337-1684359 GGCGGCCGGAGGGGGCGGGGCGG - Intergenic
968641798 4:1718504-1718526 GGATGCAGGCGATGGAGGGGAGG + Exonic
968695930 4:2026670-2026692 GCCTGCTGGGGGAGGAGAGGGGG - Intronic
968879766 4:3292969-3292991 GGCCGAGGCCGGAGGAGGGGCGG - Intergenic
968965274 4:3766327-3766349 GGCTGCGGGGGGAGGGGGGCAGG - Intronic
968969925 4:3788407-3788429 GGGTCCCGGCAGGGGAGGGGTGG + Intergenic
969096447 4:4736147-4736169 GGCTGCAGGCCCAGGAAGGGAGG + Intergenic
969285296 4:6199184-6199206 GGCGGGCGGCGGAGGAGGGCTGG + Intronic
969412943 4:7041890-7041912 GGCAGCTGTCGGATGAGGGGCGG - Exonic
969621033 4:8278996-8279018 GGATGGAGGGGGAGGAGGGGCGG - Intronic
970897144 4:21117294-21117316 GGTTGCCGGGGGGGGGGGGGGGG + Intronic
971405610 4:26319437-26319459 GGCTTGCCGCGGAGGCGGGGCGG - Intronic
972077287 4:35103887-35103909 TGCTGCCGGCTGAGGAGGGCTGG + Intergenic
973551316 4:52038377-52038399 GGATGCGGGCTGGGGAGGGGAGG - Exonic
973613709 4:52659381-52659403 GGCGGCGCGGGGAGGAGGGGCGG + Intergenic
973968238 4:56185377-56185399 GGCTGCCAGTGGCTGAGGGGAGG - Intronic
973981815 4:56314257-56314279 GGCTGCAGGCGCTGGAGAGGAGG + Exonic
976258648 4:83124869-83124891 GGGTGTGGGGGGAGGAGGGGAGG + Intronic
976310533 4:83607472-83607494 GGCTGGGGGTGGAGGTGGGGTGG + Intergenic
977044289 4:92050375-92050397 TGCTGCGGGTGGAGGCGGGGTGG - Intergenic
980130112 4:128810230-128810252 GGGGGCCGGAGGAGGAGGAGAGG + Intronic
980405095 4:132345037-132345059 TGCTTCCTGCGGGGGAGGGGCGG - Intergenic
980903842 4:138929531-138929553 AGCAGCCTGGGGAGGAGGGGAGG - Intergenic
981000635 4:139825565-139825587 GGCTGCCTGCGGCCGAGGGTAGG - Intronic
981033732 4:140151186-140151208 GGCTGGAGGAGGAGGAAGGGAGG + Intronic
983245202 4:165279695-165279717 GGCGGCGGGAGGGGGAGGGGAGG + Intronic
984702287 4:182826010-182826032 GGCTGCTGGCGGTGCATGGGGGG + Intergenic
984778542 4:183504736-183504758 GGCGGCCGCGGGCGGAGGGGCGG + Intergenic
984778545 4:183504739-183504761 GGCCGCGGGCGGAGGGGCGGGGG + Intergenic
985892286 5:2724963-2724985 TGCTGCTGCCTGAGGAGGGGAGG + Intergenic
985896341 5:2751770-2751792 TGCAGCGGGCGGAGCAGGGGAGG - Intergenic
986449491 5:7850760-7850782 GGCGGGCGGCCGCGGAGGGGCGG - Intronic
986613130 5:9589798-9589820 GGCTGGAGGTGGAGTAGGGGTGG + Intergenic
987079802 5:14416745-14416767 GGCTGCGGGTGGGGGAAGGGTGG - Intronic
988263843 5:28926624-28926646 GGCTGCAGACGGAGGAGTGGAGG + Intergenic
990509903 5:56480952-56480974 GGCTCCCGGCCGAGGAGGACAGG + Intronic
990565221 5:57021069-57021091 AGCAGCCTGGGGAGGAGGGGAGG + Intergenic
990981088 5:61602872-61602894 GGCTGAGGGCTGGGGAGGGGTGG + Intergenic
992365143 5:76083289-76083311 GGAGGCAGGCGGAGGAGAGGAGG + Exonic
992703981 5:79369391-79369413 GGCTGCAGGGGCAGGTGGGGAGG + Intergenic
994083267 5:95731349-95731371 AGCTGCCAGCCGAGGAGGCGCGG + Exonic
994670304 5:102755288-102755310 GCCTGCGGGCGGCGGAGCGGCGG - Intronic
995912534 5:117204624-117204646 GGCTGGCGAAGGGGGAGGGGGGG + Intergenic
996382927 5:122880358-122880380 GGCTGAGGGTGGAGGAGAGGAGG + Intronic
996423765 5:123290788-123290810 GGCTGCCCCAGGAGGAGGGGTGG - Intergenic
997228889 5:132228576-132228598 GGGTGGGGGCGGAGGCGGGGGGG + Intronic
997292396 5:132747392-132747414 CGCCGCCGGGGGAGGTGGGGAGG - Intergenic
998169611 5:139864807-139864829 GGCAGCCTTCGGAGCAGGGGAGG + Intronic
998188383 5:140000703-140000725 GGCTGCAGCAGGAGGAGGTGTGG - Intronic
998200421 5:140114080-140114102 GGCAGCAGGCGGAGCCGGGGAGG + Intronic
998272403 5:140718636-140718658 GGCTGAAGGCGAAGGAGGTGGGG + Intergenic
998366647 5:141636811-141636833 GGCGGCGGGCGGCGGAGGTGCGG - Exonic
999334189 5:150700901-150700923 GCCTGCCGGAGGAGGATGGAAGG - Intronic
999727159 5:154446412-154446434 GGCTTCCGGAGGCGGAGGGCCGG + Exonic
1001401926 5:171451054-171451076 GGCGGCCGGCGGCGGGGTGGGGG - Intronic
1001417463 5:171556002-171556024 GGGTGGCGGGAGAGGAGGGGAGG - Intergenic
1001586002 5:172834304-172834326 GGCGGCCGGCGGGGGCGGGGCGG + Exonic
1002045073 5:176536998-176537020 GGCAGGGGGCGGGGGAGGGGGGG + Exonic
1002089232 5:176794651-176794673 GGCTGCTGGGGAAGGAGGGCCGG - Intergenic
1002190132 5:177473567-177473589 GGCGGACGGAGGAGGAGGGAGGG + Intronic
1002381314 5:178831859-178831881 CGCTGCCAGCGGCAGAGGGGTGG - Intergenic
1002721709 5:181265345-181265367 TGCTGCTGGCAGAGGAGGAGTGG + Intergenic
1002926818 6:1609832-1609854 GGCTGCCGCCGCTGGCGGGGCGG + Intergenic
1002991856 6:2245716-2245738 GGTGGCCGTCGGCGGAGGGGCGG - Intergenic
1003162920 6:3651320-3651342 GGCTGCCGGGGGAAAAGGGAGGG + Intergenic
1003290689 6:4776299-4776321 GGCCGCCCGCGCGGGAGGGGCGG - Intronic
1003543695 6:7040615-7040637 GGCTGCAGGCAGAAAAGGGGTGG - Intergenic
1003603667 6:7541482-7541504 GGCGGCGGGCGCAGGTGGGGAGG + Intergenic
1003845916 6:10173072-10173094 GGCTGCTGGAGGAGTGGGGGAGG + Intronic
1004160196 6:13206035-13206057 GGGAGCCGGTGGTGGAGGGGAGG - Exonic
1004497664 6:16180343-16180365 GGCTGCGGGCGGGGGTGGGGTGG - Intergenic
1004528214 6:16429020-16429042 GGCTGCCAGTGGAGCAGTGGGGG + Intronic
1006300974 6:33193374-33193396 GCCGGCCGGAGGAGGAAGGGGGG - Intergenic
1006331055 6:33391484-33391506 GGCGGCCGGAGGAGAAGGGGCGG - Intergenic
1006349941 6:33513618-33513640 GGCAGCAGGTGGAGGGGGGGGGG - Intergenic
1006366870 6:33621248-33621270 AGCTGCGGGGGGAGGGGGGGCGG + Exonic
1007631626 6:43276051-43276073 GGGTGGGGGCGGAGTAGGGGAGG + Intronic
1007837007 6:44681783-44681805 TACTGCAGGCGGAGGAAGGGAGG - Intergenic
1008537561 6:52518321-52518343 GACTGCTGGGGGCGGAGGGGAGG + Intronic
1009817123 6:68750726-68750748 GGGTGCTGGCTGAGGATGGGTGG + Intronic
1010001510 6:70954900-70954922 GCCTGCCGGGGGCGGCGGGGGGG + Intronic
1010786255 6:80004536-80004558 GCCTGACGCAGGAGGAGGGGCGG + Intronic
1011464268 6:87639506-87639528 GGCTGCAGGCTCAGAAGGGGTGG - Intronic
1012551129 6:100465332-100465354 GTCTACCGGCGGAGGAGGCAGGG + Intergenic
1012981054 6:105831023-105831045 GGCAGCCGGAGGAGGAGAAGGGG + Intergenic
1013155729 6:107490040-107490062 GGCCGGCGCGGGAGGAGGGGAGG - Exonic
1013177694 6:107691305-107691327 TGCTGTCGGTGGAGGCGGGGAGG - Intergenic
1013826109 6:114213331-114213353 GGATGGCGGCGGGGGTGGGGGGG + Intronic
1016007956 6:139108475-139108497 GGGTGTCGGTGGAGCAGGGGCGG - Intergenic
1016386844 6:143537310-143537332 GGCTGGCGGCGGGGTGGGGGTGG + Intronic
1016461631 6:144285219-144285241 CGCTGGAGGCGGAGGAGGGAGGG - Intergenic
1016863697 6:148746830-148746852 TGCTGGGGGCGGAGGGGGGGAGG - Intergenic
1016996141 6:149963602-149963624 GACTGCAGGCGGAGGGAGGGCGG + Intergenic
1017000912 6:149996417-149996439 GGCTGCCTGCAGAGGAGGAGGGG + Intergenic
1017592229 6:155990064-155990086 GGAGGGAGGCGGAGGAGGGGGGG - Intergenic
1018389057 6:163329366-163329388 GGCTGCAGGGGGAGTTGGGGAGG - Intergenic
1018389101 6:163329511-163329533 GGCTGCAGGGGGAGTTGGGGAGG - Intergenic
1018389130 6:163329598-163329620 GGCTGCAGGGGGAGTTGGGGAGG - Intergenic
1018389140 6:163329627-163329649 GGCTGCAGGGGGAGTGGGGGAGG - Intergenic
1018686211 6:166307044-166307066 GGCTGCCGGCTGGCGAGGGCAGG + Exonic
1018876653 6:167827296-167827318 GGCGGGCGGCGGCGGGGGGGAGG - Intronic
1018897159 6:168027662-168027684 GGCTGTCCGGGGAGGAGGGGCGG - Intronic
1019114783 6:169751487-169751509 GACCGCCGGCGGTGAAGGGGAGG - Exonic
1019179412 6:170177263-170177285 GGCAGTCGGCGGGGGAGGGGCGG + Intergenic
1019283249 7:211121-211143 GGCTGACGGGGGAGGAGGAAGGG - Intronic
1019386084 7:757034-757056 GGCTGACGGCCGGGCAGGGGAGG - Intronic
1019398417 7:836094-836116 GGCTGCTGGGGGAGGTGGAGAGG + Intronic
1019443860 7:1060931-1060953 GGCTGCAGGGGTAGGAGGGTTGG - Intronic
1019518946 7:1452032-1452054 GGCTGCAGGCGGACGGGGCGGGG - Intronic
1019587752 7:1814237-1814259 GGCTGCTGGCGGTGAAAGGGTGG + Intergenic
1019703816 7:2488078-2488100 GGCTGGGGGCGGGGGAGAGGGGG - Intergenic
1019803406 7:3105146-3105168 GGCTGCAGTGGGAGGAGCGGAGG - Intergenic
1019935993 7:4258327-4258349 GGCAGCTGCAGGAGGAGGGGTGG + Intronic
1020201247 7:6081605-6081627 GGCAGGCGGGGCAGGAGGGGCGG + Intergenic
1021411145 7:20331018-20331040 GGCTGCGAGCGCAGGAGGGGAGG - Intronic
1021969361 7:25951375-25951397 GGCTGGGGGCGGGGGCGGGGTGG + Intergenic
1022419842 7:30210107-30210129 AGCTGCCGGAGGAGGCCGGGAGG + Intergenic
1023000261 7:35801185-35801207 GGCTGGTCGCGGAGGGGGGGAGG + Exonic
1023198426 7:37667108-37667130 GGCTGTGGGAGGAGGAGGGGAGG + Intergenic
1023818229 7:43966097-43966119 GGCAGACGGTGGAGGTGGGGGGG + Intergenic
1023818266 7:43966223-43966245 GCCTGCCGGGGGAGGAGGGGGGG + Intergenic
1023864846 7:44233754-44233776 GGCTCCCTGCCGGGGAGGGGAGG - Intronic
1024686422 7:51750845-51750867 GGCTGCCGGAGAAGGAGCGAGGG - Intergenic
1026825399 7:73578436-73578458 GGCTGCGCGCGGGGGAGGAGAGG - Exonic
1027374519 7:77537126-77537148 GGCTGCTGGCGGGGGGTGGGGGG + Intergenic
1028121308 7:87059345-87059367 GGCGGCTGGAGGAGGAGGGCAGG + Exonic
1028593941 7:92528390-92528412 GGGTGCTGGGGGAGGCGGGGCGG - Exonic
1029114945 7:98232002-98232024 GGGTGCCAGGGGAGGAGGGCGGG + Intronic
1029253355 7:99252355-99252377 GGCTGGCGGGGGGTGAGGGGAGG + Intergenic
1029339252 7:99929576-99929598 GGCTGCTGGCGGAGGAGAGCCGG - Exonic
1029347940 7:99992422-99992444 GGCTGCTGGCGGAGGAGAGCTGG + Intergenic
1029444651 7:100605219-100605241 GGCAGCCCGGGGAGGAGGGTCGG - Intronic
1029453448 7:100655542-100655564 GGCTGCTGGCCGCGGAGGAGGGG - Exonic
1029742857 7:102500929-102500951 GGCAGACGGTGGAGGTGGGGGGG + Intronic
1029742896 7:102501055-102501077 GCCTGCCGGGGGAGGAGGGGGGG + Intronic
1029760847 7:102600090-102600112 GGCAGACGGTGGAGGTGGGGGGG + Intronic
1029760886 7:102600216-102600238 GCCTGCCGGGGGAGGAGGGGGGG + Intronic
1029888600 7:103901724-103901746 GGCTGCCTGGGGATGAGAGGTGG + Intronic
1029959950 7:104680229-104680251 GGTTCCCTGCTGAGGAGGGGAGG - Intronic
1030093314 7:105876623-105876645 GGAGGGCGGCGGAGGAGGAGGGG + Intergenic
1031291235 7:119938557-119938579 GGGTGGCTGGGGAGGAGGGGAGG - Intergenic
1031449119 7:121892396-121892418 GGCTGCAAGAGGAGGTGGGGTGG + Intronic
1031688836 7:124764667-124764689 GGCTGCAGGCAGAGGGGCGGAGG - Exonic
1031986288 7:128166693-128166715 GAATGTCGGCGGAGGCGGGGAGG - Intergenic
1032345177 7:131110073-131110095 AGCTGGAGGGGGAGGAGGGGAGG + Intergenic
1033152637 7:138929033-138929055 GGCTGCTGGCTGATGAGGGTGGG + Intronic
1033223700 7:139544803-139544825 GGCTGCCGGCGGAGGTAGGCTGG + Exonic
1033253030 7:139777376-139777398 GGCCGGGGGCGCAGGAGGGGAGG - Intronic
1034129001 7:148698832-148698854 GGCGGCGGGAGGAGGAGGGCCGG + Intronic
1034331008 7:150282178-150282200 GACGGCCCGGGGAGGAGGGGTGG + Intronic
1034414126 7:150955957-150955979 GGCTGCTGGCGGAGGGGGAGGGG - Intronic
1034433329 7:151051570-151051592 GGCGGGGGGCGGGGGAGGGGAGG + Intronic
1034667035 7:152827675-152827697 GACGGCCCGGGGAGGAGGGGTGG - Intronic
1035454633 7:158999938-158999960 GGCTGCCGGGTGGGGAGCGGAGG - Intergenic
1035468706 7:159096326-159096348 GGCCGATGCCGGAGGAGGGGAGG - Intronic
1035717206 8:1763660-1763682 GGCGGCGGGCGCGGGAGGGGCGG - Intronic
1035769834 8:2138314-2138336 GGCTGCCTGGGGAGCAGGAGAGG - Intronic
1036048309 8:5167953-5167975 GGATGCTGGTGGAGGAGGAGTGG - Intergenic
1036184496 8:6612321-6612343 GGCTGGCTGTGGAGGAGAGGAGG - Intronic
1036733385 8:11285084-11285106 GGCTCCCTGCGGAGCTGGGGTGG - Intronic
1037759600 8:21733207-21733229 GGCTGCAGCCGGAGGAAGGTGGG - Intronic
1037936290 8:22917113-22917135 TGCTGGGGGCGGGGGAGGGGGGG + Intronic
1037988050 8:23301978-23302000 CCCTGCAGGGGGAGGAGGGGAGG - Intronic
1039097950 8:33907201-33907223 GGCAGCAGGAGGAGGAGGGGTGG - Intergenic
1039454620 8:37698464-37698486 GGCTGCCGGGGGCGGCGGGCGGG - Exonic
1040512777 8:48109834-48109856 GGCTTCAGGCTGAGGCGGGGAGG - Intergenic
1040729113 8:50421037-50421059 GGCGGTGGGCGGGGGAGGGGGGG + Intronic
1040816661 8:51515138-51515160 GGATGCCTGCTGAGGAGGGAAGG + Intronic
1040878907 8:52182619-52182641 GGTTGCCGGGGGATGAGGGAGGG + Intronic
1041374076 8:57194034-57194056 GGCTGCGGGAGGAGGTGGGCGGG + Intergenic
1044591300 8:93916814-93916836 GGCTGCGGCCGGGGGTGGGGCGG - Intronic
1044692898 8:94896266-94896288 CGCTGGCGGCGGCGGCGGGGCGG - Intronic
1045184152 8:99818960-99818982 GGGGGGCGGCGGGGGAGGGGTGG + Intronic
1045488745 8:102654531-102654553 GGCTGCCGGCGGGAGGAGGGCGG - Intronic
1045564445 8:103299034-103299056 GGGTGCCGGGGGAAGCGGGGAGG + Intronic
1045674086 8:104589029-104589051 GGCTGCGGGAGGGGGAAGGGAGG + Intergenic
1045885598 8:107094057-107094079 AGCTGCCGGAGGTGAAGGGGTGG - Intergenic
1047285810 8:123486324-123486346 GGCAGGCGGTGGAGGAGAGGAGG + Intergenic
1047381980 8:124372453-124372475 GCCTCCCGGCTGAGGAGGAGCGG + Exonic
1047499234 8:125429653-125429675 GGCTGCAGCCGGAGGAAGGAGGG - Intergenic
1047739307 8:127794313-127794335 GGCCGCGCGCGGAGGCGGGGCGG - Intergenic
1047775873 8:128069984-128070006 GGCTGCCTATGGAGGAGGGAAGG - Intergenic
1047917075 8:129593898-129593920 GGGTCCCAGGGGAGGAGGGGAGG - Intergenic
1048073341 8:131042363-131042385 GGATGCAGGTGGAGGAGCGGTGG + Exonic
1048881676 8:138877105-138877127 GGCTGGGGGTGGGGGAGGGGAGG - Intronic
1048980947 8:139703222-139703244 GGCGGCTGGCGGGGCAGGGGCGG + Intergenic
1049081321 8:140445513-140445535 GGCTGCCAGGAGAGCAGGGGAGG + Intronic
1049205045 8:141359697-141359719 GGCAGCCAGGGGAGGAGAGGAGG + Intronic
1049299387 8:141861682-141861704 TGCTGCCTGCAGGGGAGGGGCGG + Intergenic
1049310465 8:141931326-141931348 GGCAGCCTAAGGAGGAGGGGAGG + Intergenic
1049682118 8:143923986-143924008 AGCTGGCGGCGGAGGAGGAGCGG - Exonic
1049688915 8:143950293-143950315 CGCTGCCGACGGAGGAGCAGCGG - Exonic
1049694282 8:143976043-143976065 GACTGCGGGCTGAGGTGGGGTGG - Intronic
1049746884 8:144266764-144266786 GGCGCCCGGCGGAGGGCGGGGGG + Exonic
1049792481 8:144478328-144478350 GGCTGGCGACGGAGGAGGCCGGG + Intronic
1049796852 8:144500945-144500967 GGCTGCCGGCGCTGGAGGTGCGG - Exonic
1049808257 8:144551198-144551220 GGTTGCTGGGGGAGGATGGGGGG + Intronic
1049883086 9:11162-11184 GGCTGGGGGCGGGGGGGGGGGGG + Intergenic
1049989405 9:977315-977337 GGCTGGCGGCGGCTGCGGGGCGG - Exonic
1050166580 9:2770642-2770664 GGCTGCGGGGGGTGGAGGGAGGG + Intronic
1051356502 9:16244038-16244060 GGATGCAGGGGGAGGAGGGGAGG - Intronic
1052192864 9:25678401-25678423 GGGTGACGACGGAGGAGGAGAGG + Exonic
1052854412 9:33398247-33398269 GGCTGGCCACGGAGGAGTGGAGG + Intronic
1053157537 9:35791511-35791533 GGCAGCCGGCGCCGGAGGGTGGG + Intergenic
1053477405 9:38392565-38392587 GGCTGCCGGGGGTAGAGGGGCGG + Intergenic
1053682417 9:40494408-40494430 GGCTGGCCACGGAGGAGTGGAGG + Intergenic
1053690324 9:40583802-40583824 GGCTGCAGACAGAGGAGTGGAGG - Intergenic
1053932400 9:43122734-43122756 GGCTGGCCACGGAGGAGTGGAGG + Intergenic
1054281297 9:63130521-63130543 GGCTGGCCACGGAGGAGTGGAGG - Intergenic
1054295516 9:63329908-63329930 GGCTGGCCACGGAGGAGTGGAGG + Intergenic
1054301575 9:63384763-63384785 GGCTGCAGACAGAGGAGTGGAGG - Intergenic
1054393536 9:64634412-64634434 GGCTGGCCACGGAGGAGTGGAGG + Intergenic
1054428185 9:65139626-65139648 GGCTGGCCACGGAGGAGTGGAGG + Intergenic
1054496152 9:65824994-65825016 GCCTGCCGGGGGCGGGGGGGGGG - Intergenic
1054502195 9:65881918-65881940 GGCTGGCCACGGAGGAGTGGAGG - Intronic
1057286939 9:93764396-93764418 GGCTGCGAGCAGAGGAGGGTGGG - Intergenic
1059346502 9:113632565-113632587 GGGTGCAGGGGGAGGAGGCGTGG + Intergenic
1059768185 9:117403545-117403567 GGCTGAGGGCGGAGGAGGGAAGG - Intronic
1060014495 9:120074908-120074930 GGCTGCCAGCAGCGGAGGGGAGG - Intergenic
1060177323 9:121506456-121506478 GGCTGATGGGGGAGGAGGGAGGG + Intergenic
1060194716 9:121616189-121616211 GGATGCAGGCGAGGGAGGGGCGG + Intronic
1060897489 9:127226640-127226662 GACTTCCGAAGGAGGAGGGGTGG - Intronic
1060916710 9:127396508-127396530 GGCTGCTGGCGGCGGAGGCGTGG - Intergenic
1060979751 9:127785492-127785514 GGGGGCGGGCGGAGGAGGAGGGG + Intergenic
1060979752 9:127785495-127785517 GGCGGGCGGAGGAGGAGGGGAGG + Intergenic
1060979922 9:127785985-127786007 GGCGGCGGGCGGAAGAGGCGGGG + Intronic
1061059922 9:128245174-128245196 GGCGGCTGGGGGAGGAGAGGAGG - Intronic
1061237747 9:129352219-129352241 GGCTCCCGGGGGATGGGGGGAGG + Intergenic
1061285603 9:129620623-129620645 GGGCGCCGGCTGAGGTGGGGAGG + Exonic
1061487682 9:130928644-130928666 GGCTGCTGGGGGCGGTGGGGCGG + Intronic
1061859559 9:133460868-133460890 GGATGCGTGCGGAGAAGGGGAGG - Intronic
1061865686 9:133490834-133490856 AGGTGCTGGAGGAGGAGGGGAGG + Intergenic
1062024093 9:134332508-134332530 TGCTGCCTGTGGAGGAGGGGTGG + Intronic
1062105762 9:134753940-134753962 CGCTGCCGCCGGAGAACGGGAGG - Intronic
1062230685 9:135479998-135480020 GGCGGGCGGCGGGGGACGGGCGG + Exonic
1062284810 9:135768231-135768253 GGATGCCTGCGGGGGGGGGGGGG + Intronic
1062289498 9:135788208-135788230 GGCTGCCGGCGGTGAAGGGTTGG - Intronic
1062382280 9:136292205-136292227 TGGTGCCTGCGGAGGACGGGAGG + Exonic
1062429350 9:136520087-136520109 GGCAGCCTGTGGAGGAGGAGGGG - Intronic
1062474541 9:136720559-136720581 GGGTGGGGGCTGAGGAGGGGCGG + Intronic
1062583457 9:137238231-137238253 AGCTGCAGGAGGAGGAGGGCAGG + Intergenic
1203731829 Un_GL000216v2:98650-98672 GGCTCCCGGAGCAGGAGGCGCGG + Intergenic
1203621019 Un_KI270749v1:130072-130094 GGCTGCAGACAGAGGAGTGGAGG - Intergenic
1185464220 X:345734-345756 GGCTGCGGGCGGGGCAGGGAAGG + Intronic
1185645013 X:1609967-1609989 GGCTGGAGGAGGAGCAGGGGCGG - Intergenic
1186410757 X:9342761-9342783 GGCGGCCGGCGGCGTGGGGGCGG - Intergenic
1187009465 X:15265289-15265311 GGATGCAGGATGAGGAGGGGAGG - Intronic
1187100059 X:16183238-16183260 AGCAGCCTGGGGAGGAGGGGAGG + Intergenic
1187572419 X:20518635-20518657 TGCAGCCGGGGGAGGAGTGGTGG - Intergenic
1187651457 X:21413068-21413090 GGCTGCCAGAGGCTGAGGGGAGG - Intronic
1187833750 X:23409589-23409611 GGCTGCCAGGGGAAGAGGGGTGG + Intergenic
1187833959 X:23411882-23411904 GGGTGGCGGGGGAGGTGGGGTGG + Intergenic
1188242669 X:27809517-27809539 GGCCGGCGGCGGGGGGGGGGCGG - Intronic
1188242670 X:27809520-27809542 GGGGGCCGGCGGCGGGGGGGGGG - Intronic
1189318891 X:40075304-40075326 GGCTTCCGGCGGGGCGGGGGTGG + Intronic
1189380872 X:40501288-40501310 AGCTGAGGGCGGAGGAGGGATGG - Intergenic
1195066947 X:101245736-101245758 GGCTGCCAGTGGCTGAGGGGAGG + Intronic
1195668261 X:107449593-107449615 GCCGGACGGCCGAGGAGGGGAGG - Intergenic
1195702610 X:107716428-107716450 GGCAGCCGGAGGCAGAGGGGCGG - Intronic
1196707262 X:118727454-118727476 AGCGGCCGGAGGAGGCGGGGCGG - Intergenic
1196992785 X:121347067-121347089 AGCAGCCTGGGGAGGAGGGGAGG + Intergenic
1197195916 X:123700510-123700532 GGCTGGGGGCGGCGGGGGGGAGG + Intronic
1198276294 X:135098274-135098296 GGCGGGGGGCGGAGGTGGGGCGG - Intergenic
1198310216 X:135422466-135422488 GGCGGGGGGCGGAGGCGGGGCGG + Intergenic
1198750308 X:139932208-139932230 GGCTGCGGGCGGCTGGGGGGCGG - Intronic
1199035179 X:143041866-143041888 GCTTTCCGGCGGAGGGGGGGCGG + Intergenic
1199600591 X:149539403-149539425 AGCTGCCGGAGGAGGAGCTGGGG - Intergenic
1199607514 X:149587525-149587547 GGGTTCTGGCGGAGTAGGGGTGG + Intergenic
1199631609 X:149781842-149781864 GGGTTCTGGCGGAGTAGGGGTGG - Intergenic
1199880916 X:151973919-151973941 GGCTGTCAGCGGTGGAGAGGGGG + Intronic
1200053475 X:153446618-153446640 GGCTGCTGGGGAAGGAAGGGAGG + Intronic
1200069018 X:153518645-153518667 GCCAGCCGGCTGAGGAGGGGTGG + Intronic
1201300217 Y:12498666-12498688 AGCAGCAGGAGGAGGAGGGGAGG - Intergenic