ID: 1110221867

View in Genome Browser
Species Human (GRCh38)
Location 13:73082376-73082398
Sequence ATCTAACCAAAGATGGAATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 199
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 189}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110221867_1110221870 8 Left 1110221867 13:73082376-73082398 CCAAATTCCATCTTTGGTTAGAT 0: 1
1: 0
2: 0
3: 9
4: 189
Right 1110221870 13:73082407-73082429 ACAGTGTGAAACTAATCAATGGG 0: 1
1: 0
2: 0
3: 11
4: 142
1110221867_1110221869 7 Left 1110221867 13:73082376-73082398 CCAAATTCCATCTTTGGTTAGAT 0: 1
1: 0
2: 0
3: 9
4: 189
Right 1110221869 13:73082406-73082428 TACAGTGTGAAACTAATCAATGG 0: 1
1: 0
2: 1
3: 14
4: 148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110221867 Original CRISPR ATCTAACCAAAGATGGAATT TGG (reversed) Intergenic
906947122 1:50304362-50304384 ATCAATCTAGAGATGGAATTAGG + Intergenic
906964142 1:50440025-50440047 TTCTAACCAAAGCTGGAGATAGG - Exonic
908652929 1:66355895-66355917 GTCTTAGCAAAGATGGAAGTAGG - Intronic
910199479 1:84684139-84684161 CTATAACCAATGATTGAATTTGG - Intronic
910503713 1:87925063-87925085 TTCTAATTAAAGATGGAATTGGG + Intergenic
911726845 1:101250852-101250874 ACTTAACCAAAAAAGGAATTCGG - Intergenic
912277143 1:108271868-108271890 ATCTAACTAAAAATTGACTTTGG - Intergenic
912291085 1:108422488-108422510 ATCTAACTAAAAATTGACTTTGG + Intronic
912689236 1:111791931-111791953 ATCCAGCCAAGGATGGCATTAGG - Intronic
914784462 1:150816114-150816136 CTCTCAACAAAGATGGAAATTGG + Intronic
915668950 1:157470850-157470872 ACCTAACTTAAGATGGTATTTGG + Intergenic
917661101 1:177177951-177177973 CTTTAACCAAAGCAGGAATTTGG - Intronic
918386287 1:184011283-184011305 ATTTAATGAAAGCTGGAATTGGG + Intronic
919020391 1:192097967-192097989 ATTTAAGCAAAAATGGAGTTTGG + Intergenic
921290293 1:213650721-213650743 AACTAAACAAAAATGGAATGGGG - Intergenic
921488015 1:215738751-215738773 CTCAAACCAAAGATAGGATTTGG - Intronic
1063642373 10:7842733-7842755 ATTTTACAAATGATGGAATTTGG - Intronic
1067021206 10:42799898-42799920 ATGTAACCAAAGAAAGAAATGGG - Intronic
1069951796 10:72024128-72024150 AGCTAACCCATGATGGAATTGGG - Intergenic
1070400107 10:76045847-76045869 ATCCAACCAATGTCGGAATTGGG - Intronic
1070955958 10:80463911-80463933 ACTGAACCAAAGATGGACTTGGG - Intronic
1074729103 10:116349478-116349500 AGCTGACCTAATATGGAATTGGG - Intronic
1078591728 11:12647176-12647198 ATCTAACAAAATATGTATTTAGG + Intergenic
1081196745 11:40170414-40170436 CTTTCACCAAAGATGTAATTTGG - Intronic
1081361962 11:42190909-42190931 ACCTAACCAAAGATGGGTTAGGG - Intergenic
1086272541 11:85084348-85084370 ATCTAAGAAAATATGGAAGTAGG + Intronic
1086561100 11:88170463-88170485 ATTCAACCAAAGATAGGATTCGG - Intronic
1088064107 11:105694962-105694984 ATCTAAACAGATATGGAATCTGG + Intronic
1090514067 11:127406054-127406076 CTCTAACTATTGATGGAATTGGG - Intergenic
1091100900 11:132872636-132872658 ATCTGACCAAAGGAGGACTTAGG - Intronic
1091480644 12:826793-826815 ATCTAAACAATGATAGTATTAGG - Intronic
1093516645 12:19994768-19994790 ATATGACCAAAGAAAGAATTTGG + Intergenic
1093699844 12:22206977-22206999 ATATAACAAATGATGGATTTGGG + Intronic
1099412621 12:82349919-82349941 ATCTTACCAAGTATAGAATTTGG + Intronic
1100216964 12:92461007-92461029 ATCTAAACCAAAATGGATTTTGG + Intergenic
1102661810 12:114535475-114535497 AACTAAATAAAGATGGAATGAGG - Intergenic
1102665935 12:114572861-114572883 AGCTAAATAAAGATGGAATGAGG + Intergenic
1102960141 12:117087187-117087209 AATTAACCAAAGATGCATTTGGG + Intronic
1105331074 13:19415824-19415846 AGTTAACCAAGCATGGAATTGGG + Intergenic
1105919111 13:24944130-24944152 AGTTAACCAAGCATGGAATTGGG + Intergenic
1107533191 13:41304065-41304087 ATCTCACCGAAGAAAGAATTTGG - Intergenic
1108726284 13:53184931-53184953 ATTTGACAAGAGATGGAATTTGG + Intergenic
1110221867 13:73082376-73082398 ATCTAACCAAAGATGGAATTTGG - Intergenic
1111500434 13:89112842-89112864 ATATAACCACAAATGGAATTAGG - Intergenic
1111864280 13:93749272-93749294 ATCTTACCAAAGATAAAAGTAGG - Intronic
1112226339 13:97544180-97544202 ATTTTACCAAAAAAGGAATTTGG - Intergenic
1112632173 13:101173652-101173674 AACGGAGCAAAGATGGAATTTGG + Intronic
1113153810 13:107294341-107294363 ATCTAACCTAAGATTCATTTTGG - Intronic
1114589632 14:23849170-23849192 ATCAAACAAAATATTGAATTAGG - Intergenic
1123010035 14:105345104-105345126 ATCTCAAAAAAGATGGAATCTGG + Intronic
1127399200 15:58569038-58569060 ATTTAACCAGAGATAAAATTGGG - Exonic
1127817822 15:62627406-62627428 GGCTAGCCAAAGAGGGAATTAGG + Intronic
1131366896 15:91849168-91849190 GTCCAACCAAGGATAGAATTGGG - Intergenic
1133899005 16:9955713-9955735 ACAAAACCAAAAATGGAATTAGG - Intronic
1134790047 16:16981595-16981617 ATCTCACACAAGAAGGAATTTGG + Intergenic
1135915889 16:26605142-26605164 TTCTGACTAAAGATGAAATTGGG + Intergenic
1137484368 16:48879372-48879394 ATGTAAACAAACATGGCATTTGG + Intergenic
1144885686 17:18458102-18458124 ATTTAATCTAAGTTGGAATTGGG - Intergenic
1145146528 17:20486268-20486290 ATTTAATCTAAGTTGGAATTGGG + Intergenic
1146236884 17:31174658-31174680 ATCTAATAAATGATTGAATTGGG - Intronic
1146560689 17:33867056-33867078 ATCCAACCACAGTTGGAATCTGG + Intronic
1147345137 17:39786859-39786881 ATAAAACCAAAGATGCCATTAGG + Intronic
1149638878 17:58190741-58190763 ATGTAACCCAGGATAGAATTGGG - Intergenic
1153079972 18:1210979-1211001 ATATGAGCAAAGATGCAATTAGG - Intergenic
1155783353 18:29868185-29868207 TTCTAACCAAAAATAAAATTAGG - Intergenic
1156297238 18:35803845-35803867 ATATAACCATGGAAGGAATTAGG - Intergenic
1157020772 18:43778923-43778945 ATGTAACCAGAGATGAAACTAGG + Intergenic
1158226470 18:55206471-55206493 ATTTAACCAAACATGCATTTAGG + Intergenic
1158388627 18:57023636-57023658 ATCTATCAAATGATGTAATTTGG + Intronic
1163874939 19:19860204-19860226 ACCTAACCAACGATTGAATATGG + Intergenic
1163919475 19:20275442-20275464 ATCTAACCAATTATTGAATTTGG + Intergenic
1164100908 19:22053481-22053503 ATCTAACCAATTACTGAATTTGG - Intronic
1164199130 19:23002465-23002487 ACCTAACCAATTATCGAATTTGG + Intronic
1164226247 19:23249085-23249107 ACCTAACCAATTATTGAATTTGG + Intronic
1164997423 19:32732480-32732502 ATCTCAGCAAAGAGGGAATAGGG + Intronic
1165296456 19:34930248-34930270 ATCAAACCACAGATGGATGTAGG - Intronic
925707026 2:6695584-6695606 ATTTAACAATAGATGGGATTAGG + Intergenic
927200636 2:20575972-20575994 AACAAAACAAAGATGGAAATGGG - Intronic
928757025 2:34538965-34538987 ATCTAACCAAAAATAAAATAGGG - Intergenic
930551828 2:52845017-52845039 ATCTAACCATACAGTGAATTAGG - Intergenic
931232140 2:60383854-60383876 ACCTAACCAAGGCTGGAATTTGG + Intergenic
931954476 2:67404728-67404750 ATCTAAACAAGGAAGTAATTTGG + Exonic
932633025 2:73363030-73363052 ATCAAACTAAAGAAGCAATTAGG - Intergenic
934810237 2:97271150-97271172 CTCAAACCTAAGATGTAATTAGG - Intergenic
934827455 2:97436789-97436811 CTCAAACCTAAGATGTAATTAGG + Intergenic
935448532 2:103182986-103183008 ATATCTCCAAAGCTGGAATTGGG + Intergenic
935655796 2:105421632-105421654 ATCAACCTAAAGATGGAATTTGG - Intronic
936674954 2:114704167-114704189 ATCTAGATAAAGATGGGATTAGG + Intronic
937523422 2:122738613-122738635 ATTTAAACAAAGATGAATTTGGG - Intergenic
938170346 2:129070219-129070241 CTCTAGCCAAAGATGGAGTGAGG + Intergenic
939636348 2:144587051-144587073 ATCTACCAAAAGCTGCAATTTGG - Intergenic
944809202 2:203311498-203311520 TTCAAACCCAAGATGAAATTTGG + Intergenic
945170649 2:206991196-206991218 ATCTGGTCAAAGATGGCATTAGG - Intergenic
946818778 2:223609097-223609119 ATTTGCCCAAAGATGGAATAGGG - Intergenic
947326394 2:228983193-228983215 ATTTAACCAATGTTGTAATTTGG + Intronic
1169617668 20:7468308-7468330 ATCTATCCAATGATGAAAGTGGG + Intergenic
1170033936 20:11970351-11970373 AACTCACCAAAGATGGTGTTGGG - Intergenic
1174119573 20:48252589-48252611 ATCTAACCAAAAATGTCAGTAGG + Intergenic
1174758134 20:53180251-53180273 ATGTAATGAAAGATGGATTTTGG - Intronic
1174873734 20:54206557-54206579 ATTTAACCAAAGAGGAAATTGGG + Intergenic
1176741930 21:10612800-10612822 AGTTAACCAAGCATGGAATTGGG - Intergenic
1177157961 21:17517717-17517739 ATCTTACAAAAGGTGGGATTAGG + Intronic
1180563810 22:16646037-16646059 AGTTAACCAAGCATGGAATTGGG - Intergenic
1183813731 22:40280983-40281005 CAATAACCAAGGATGGAATTTGG - Intronic
1183879811 22:40818069-40818091 AGCTAACAAATGATGGAGTTAGG + Intronic
949225442 3:1688183-1688205 ATTTAACCAGAGATAAAATTAGG + Intergenic
951649310 3:24932020-24932042 AGGTATCCAAAGATGGAACTTGG - Intergenic
951665461 3:25118359-25118381 ATCTATCCCAGGATGGAATGTGG + Intergenic
952219550 3:31311576-31311598 ATCTCACCCAAGAAAGAATTTGG + Intergenic
954098001 3:48346531-48346553 ATCCAACAGAAGATGGACTTGGG + Intergenic
954829208 3:53404330-53404352 ATCTCTTCAAATATGGAATTTGG - Intergenic
956326258 3:68056135-68056157 CTCTTACCTAAGATTGAATTGGG - Intronic
957617949 3:82555903-82555925 ATGAAACCCAAAATGGAATTGGG - Intergenic
958489938 3:94759687-94759709 GTTTGGCCAAAGATGGAATTGGG + Intergenic
959581086 3:107983341-107983363 CTGGGACCAAAGATGGAATTAGG - Intergenic
959795576 3:110424151-110424173 ATGTAACCATATATGGAAATAGG + Intergenic
959836405 3:110923588-110923610 TTCTAAGCAAAGAAGGAATCAGG + Intergenic
959956535 3:112244767-112244789 CTGTATCCACAGATGGAATTAGG + Intronic
960422989 3:117471270-117471292 ACCAAACCAAGGCTGGAATTAGG + Intergenic
961352520 3:126313044-126313066 ATGGAACCAAATTTGGAATTAGG + Intergenic
962595654 3:136940930-136940952 ATCCAAACAAAGATGCAAATAGG - Intronic
963965919 3:151370267-151370289 AGGTACCCAAAGTTGGAATTAGG - Intronic
965487674 3:169298551-169298573 TTCAAATCAAAGATTGAATTTGG + Intronic
966689405 3:182727557-182727579 TTCTAACAAAATAGGGAATTTGG + Intergenic
970505397 4:16724185-16724207 AGCTGACCAGAGATGGACTTTGG - Intronic
973074256 4:45903242-45903264 ATCTAACCAATGGTGAAAGTGGG - Intergenic
973110973 4:46397461-46397483 AACTAACGAAAGATGGAAACAGG - Intronic
973177792 4:47229469-47229491 ATCCAAACAAAAATTGAATTTGG + Intronic
973966886 4:56172058-56172080 ATCTAGCCAAGGCTGGAAATGGG + Intronic
979896188 4:126160990-126161012 ATCTCACTAAAGAGAGAATTGGG + Intergenic
980733407 4:136850261-136850283 ACAGAACCAAAAATGGAATTGGG + Intergenic
981339547 4:143604982-143605004 ATCTAATTAAAGATCAAATTGGG + Intronic
981955109 4:150462171-150462193 ATCTAACCATGCATAGAATTTGG - Intronic
984152944 4:176157040-176157062 ATGTAACCATATATGGAAATAGG - Intronic
984826869 4:183933280-183933302 ATTTAGCCAAAGACGTAATTGGG + Intronic
987441254 5:17959853-17959875 AACTAAACAAAAATGGAAATGGG + Intergenic
988062479 5:26190380-26190402 ATCTATCCATAGATGGGGTTGGG + Intergenic
991496820 5:67234998-67235020 ATCTGACCAAAACTGGAACTTGG + Intergenic
991632273 5:68668027-68668049 ATGGAACCACAGATGGAGTTAGG - Intergenic
994241954 5:97432862-97432884 ATTCAACCATAGATTGAATTTGG + Intergenic
995446286 5:112247681-112247703 TTCTTACAAATGATGGAATTGGG + Intronic
995446355 5:112248596-112248618 TTCTTACAAATGATGGAATTGGG - Intronic
997876733 5:137555997-137556019 ATTTATCCAATGATGAAATTTGG + Intronic
998143702 5:139713594-139713616 ATCTTTCCAAAGAGGGAAGTGGG - Intergenic
1000815982 5:165922421-165922443 ATCCAACCAAACATTGCATTTGG - Intergenic
1000816095 5:165923540-165923562 ATCCAACCAAACATTGCATTTGG - Intergenic
1001793204 5:174479084-174479106 AACTATCCAAAAATGAAATTAGG + Intergenic
1005448459 6:25950605-25950627 ATCTCACACAAGAAGGAATTTGG + Intergenic
1010133372 6:72522136-72522158 ATCAAAAGAAATATGGAATTAGG + Intergenic
1011267512 6:85538246-85538268 ATCTAAACAAACATACAATTAGG + Intronic
1012067810 6:94572348-94572370 ATCTAATCAAACATGGTATTGGG + Intergenic
1012385772 6:98680506-98680528 ATCTAACTAATGATGTAGTTGGG - Intergenic
1013402497 6:109812499-109812521 ATGTAAGCAAAGAGGGAAATAGG + Intronic
1014214298 6:118737846-118737868 ATATAAACAAAGAAGGAATAGGG + Intergenic
1015233356 6:130942220-130942242 ATCACACAAAAGCTGGAATTAGG - Intronic
1015963317 6:138672422-138672444 ATAAAACTAAAAATGGAATTAGG + Intronic
1016578716 6:145602705-145602727 ATCTAACAGAAAATGAAATTAGG - Intronic
1016627718 6:146191741-146191763 ATCCAACCAAAGATGGATACGGG - Intronic
1018001613 6:159583636-159583658 ATCTGACAAAAGGTGAAATTAGG + Intergenic
1018248643 6:161846058-161846080 ATCTAACAAAAGATAAAAATAGG + Intronic
1020846574 7:13292287-13292309 ATCTGAGTAAAGATGGATTTTGG + Intergenic
1025321854 7:58102950-58102972 ATTAAACCAAAGAGGGACTTGGG + Intergenic
1025556556 7:62316673-62316695 ATTAAACCAAAGAGGGACTTGGG - Intergenic
1026563918 7:71473871-71473893 ATCTCACAAAAGAAAGAATTCGG + Intronic
1029031883 7:97477340-97477362 ATCTAAGGAGAGATAGAATTGGG + Intergenic
1030156489 7:106460606-106460628 ATCTCACCCAAGAAAGAATTTGG + Intergenic
1030459860 7:109820892-109820914 ATCTAAATAAAGATGAATTTTGG - Intergenic
1031102102 7:117493812-117493834 TTCAAACTAAACATGGAATTGGG - Intronic
1031982088 7:128134703-128134725 ATTTAATCAAAGTTGGAGTTTGG + Intergenic
1032259349 7:130322435-130322457 ATCTAACCCAGGAGGGAACTGGG + Intronic
1033901943 7:146154001-146154023 TTCTTACCAAAGAAGCAATTTGG + Intronic
1035643968 8:1204363-1204385 ATTTAAAGAAAGATGGATTTTGG + Intergenic
1037645721 8:20791013-20791035 ATCAAACCAAGCATGCAATTTGG - Intergenic
1038652558 8:29418983-29419005 ATCTTAATAAAGATGGAATCTGG + Intergenic
1039666057 8:39529541-39529563 ATTTAAACTAAGATGGGATTGGG + Intergenic
1043520559 8:81040819-81040841 ATCTAGTCAAAGAAGGAATATGG + Intronic
1045595741 8:103653053-103653075 ATTTGACTAAAGATTGAATTTGG - Intronic
1045727604 8:105193665-105193687 ATCTCTCCAAAGATGAAAGTGGG + Intronic
1045745644 8:105417817-105417839 ATATGACCAGAGTTGGAATTAGG + Intronic
1047892730 8:129330645-129330667 ATCAAACCAAATATAGAATAGGG - Intergenic
1050329005 9:4526507-4526529 ATCTAAGAGAAGATGGAATTGGG + Intronic
1050480529 9:6082785-6082807 ATCTGACCAAAGAGGGAGGTTGG - Intergenic
1052045560 9:23790109-23790131 CTCTAACCAAAGAATGATTTAGG - Intronic
1056942003 9:90964077-90964099 AGATAAATAAAGATGGAATTGGG - Intergenic
1203624679 Un_KI270750v1:2766-2788 CTTTAACCATAGAAGGAATTTGG - Intergenic
1185815592 X:3152190-3152212 ATGGAACCACTGATGGAATTTGG - Intergenic
1186606818 X:11100871-11100893 ATTTATTCAAAGCTGGAATTTGG - Intergenic
1188537886 X:31217682-31217704 ATCTAAGCAAATATAAAATTAGG + Intronic
1188930241 X:36100444-36100466 ATCTACCCACAAATGCAATTTGG - Intronic
1189086126 X:38026453-38026475 ATCTCACACAAGAAGGAATTGGG + Intronic
1189726381 X:43971130-43971152 ATCTAACTAGAGATGGCATATGG + Intronic
1190989527 X:55531983-55532005 ATTTCACCAAAGAAGGTATTTGG - Intergenic
1192798813 X:74446734-74446756 ACCTATCCAAAGATGGCAGTGGG - Intronic
1195526338 X:105894446-105894468 AAGTCACAAAAGATGGAATTTGG - Intronic
1196023357 X:111013399-111013421 ACCTAATGAGAGATGGAATTAGG - Intronic
1196157653 X:112448696-112448718 AGCTATCCAAAGATGCAGTTGGG - Intergenic
1198708811 X:139478887-139478909 ATATAACTAAAGAGGGAAGTAGG + Intergenic
1199217672 X:145279528-145279550 ATCTGTCCAAAGCTGGAAATGGG + Intergenic
1202600254 Y:26586987-26587009 AGTTAACCAAGCATGGAATTGGG - Intergenic