ID: 1110222570

View in Genome Browser
Species Human (GRCh38)
Location 13:73089288-73089310
Sequence CTTTGGAAGGGCAAGGTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110222570_1110222579 12 Left 1110222570 13:73089288-73089310 CCTCCCACCTTGCCCTTCCAAAG No data
Right 1110222579 13:73089323-73089345 AAGGCATGAGCCGTGGTGCCTGG No data
1110222570_1110222578 5 Left 1110222570 13:73089288-73089310 CCTCCCACCTTGCCCTTCCAAAG No data
Right 1110222578 13:73089316-73089338 AGATTACAAGGCATGAGCCGTGG No data
1110222570_1110222576 -7 Left 1110222570 13:73089288-73089310 CCTCCCACCTTGCCCTTCCAAAG No data
Right 1110222576 13:73089304-73089326 TCCAAAGTGCTGAGATTACAAGG 0: 11
1: 421
2: 4461
3: 4264
4: 3111

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110222570 Original CRISPR CTTTGGAAGGGCAAGGTGGG AGG (reversed) Intergenic
No off target data available for this crispr