ID: 1110226204

View in Genome Browser
Species Human (GRCh38)
Location 13:73122273-73122295
Sequence CCACCTTGTCACCACCTCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110226204_1110226212 23 Left 1110226204 13:73122273-73122295 CCCCTGAGGTGGTGACAAGGTGG No data
Right 1110226212 13:73122319-73122341 ACAAGATGGAAATACCGTCCTGG No data
1110226204_1110226208 -9 Left 1110226204 13:73122273-73122295 CCCCTGAGGTGGTGACAAGGTGG No data
Right 1110226208 13:73122287-73122309 ACAAGGTGGAAGACCTTAAATGG No data
1110226204_1110226210 9 Left 1110226204 13:73122273-73122295 CCCCTGAGGTGGTGACAAGGTGG No data
Right 1110226210 13:73122305-73122327 AATGGCCAAATTAGACAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110226204 Original CRISPR CCACCTTGTCACCACCTCAG GGG (reversed) Intergenic
No off target data available for this crispr