ID: 1110230484

View in Genome Browser
Species Human (GRCh38)
Location 13:73162493-73162515
Sequence CACTTGAATCCAGGAGACGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 154563
Summary {0: 22, 1: 910, 2: 11219, 3: 45370, 4: 97042}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110230476_1110230484 17 Left 1110230476 13:73162453-73162475 CCTGTAATCCCAGCTGCTCCTGA 0: 4
1: 248
2: 7826
3: 125654
4: 268880
Right 1110230484 13:73162493-73162515 CACTTGAATCCAGGAGACGGAGG 0: 22
1: 910
2: 11219
3: 45370
4: 97042
1110230478_1110230484 9 Left 1110230478 13:73162461-73162483 CCCAGCTGCTCCTGAGGCTGAGG 0: 8
1: 481
2: 16136
3: 237526
4: 284293
Right 1110230484 13:73162493-73162515 CACTTGAATCCAGGAGACGGAGG 0: 22
1: 910
2: 11219
3: 45370
4: 97042
1110230480_1110230484 8 Left 1110230480 13:73162462-73162484 CCAGCTGCTCCTGAGGCTGAGGC 0: 8
1: 446
2: 14202
3: 215614
4: 265929
Right 1110230484 13:73162493-73162515 CACTTGAATCCAGGAGACGGAGG 0: 22
1: 910
2: 11219
3: 45370
4: 97042
1110230481_1110230484 -1 Left 1110230481 13:73162471-73162493 CCTGAGGCTGAGGCACGAGAATC 0: 124
1: 3259
2: 6804
3: 4413
4: 2990
Right 1110230484 13:73162493-73162515 CACTTGAATCCAGGAGACGGAGG 0: 22
1: 910
2: 11219
3: 45370
4: 97042

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110230484 Original CRISPR CACTTGAATCCAGGAGACGG AGG Intergenic
Too many off-targets to display for this crispr