ID: 1110244376

View in Genome Browser
Species Human (GRCh38)
Location 13:73305441-73305463
Sequence ATCTATTGCTTTATGTAAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 247
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 230}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110244376 Original CRISPR ATCTATTGCTTTATGTAAGT GGG Intergenic
903030391 1:20459716-20459738 ATCTTTTGCTTTATCATAGTGGG - Intergenic
903407792 1:23113083-23113105 TTCTAGTTCTTTATGTAATTTGG - Intronic
906440219 1:45836663-45836685 ATCTATATCTATATGTCAGTTGG + Intronic
909104194 1:71388715-71388737 ATTGATTGATTTATGTAAGTTGG - Intergenic
909452347 1:75812157-75812179 ATGTATTGGCTTATGTAACTGGG + Intronic
910169138 1:84359111-84359133 ATAGATTGCTGAATGTAAGTAGG + Intronic
910663333 1:89697136-89697158 ATCTATTCCTTCATGTAGATTGG + Intronic
910868586 1:91810454-91810476 ATCTATTGCTTCATTTATTTGGG + Intronic
919546843 1:198933793-198933815 ATGTATTGTTTTTTGAAAGTAGG + Intergenic
919957945 1:202438275-202438297 ATTTTTTGCTTTAGGTAAGGGGG - Intronic
920889646 1:209971685-209971707 ATTTATTGATTTATGTATGTTGG + Intronic
920892020 1:209996806-209996828 ATTTTTTGATTTATGTATGTTGG - Intronic
921418345 1:214916863-214916885 AATTATTGCTTTATGTACTTAGG + Intergenic
922967368 1:229701876-229701898 ATGTTTTGCTTTATGTATTTTGG - Intergenic
923058155 1:230444419-230444441 ATTTATTGCTGTATGTTATTTGG + Intergenic
923207718 1:231774960-231774982 AGCTATTGATGTATGTAAGATGG - Intronic
924837232 1:247663181-247663203 ATCTATTAATTGATGAAAGTGGG + Intergenic
924926321 1:248686427-248686449 CTCTTTTGCTTGATATAAGTGGG - Intergenic
1063557106 10:7091378-7091400 ATCTGTTGCTTTCTGTAACAGGG + Intergenic
1063973086 10:11395126-11395148 ATCTATTACTTCATGGAAATAGG + Intergenic
1065459283 10:25939686-25939708 ATCTATTCTTTTTTGTATGTAGG + Intronic
1066173365 10:32876715-32876737 ATCTTTTCCTTTTTCTAAGTTGG - Intronic
1072340279 10:94440801-94440823 ACCTATTTTTTTATGTAAGCAGG - Intronic
1073896634 10:108168088-108168110 TTCTATCCCTTTATGTAAGTAGG + Intergenic
1074123000 10:110507125-110507147 GTCTATTGCTTCTTGAAAGTGGG - Exonic
1074484288 10:113857998-113858020 ATCTAATTGTTTATGTAATTAGG + Intronic
1074734579 10:116416119-116416141 ATATATTGGTTTATGTAATGAGG + Intergenic
1076229525 10:128808491-128808513 GTCTATTGCTTTATGCAACCAGG - Intergenic
1078907923 11:15704689-15704711 ATTTCTTCCTTTATGTAACTGGG + Intergenic
1079711353 11:23686451-23686473 ATTTATTGCTTTATCTAATATGG + Intergenic
1079819633 11:25109004-25109026 ATCTATTGACTTATGAAATTTGG + Intergenic
1081082146 11:38755693-38755715 ATCTTTTCCTTTAGGTAATTAGG - Intergenic
1082173834 11:49038810-49038832 ATATTTTACTTTATGTATGTTGG - Intergenic
1084622807 11:70285009-70285031 ATGTATTTCTTTATTTAAGATGG + Intronic
1086338011 11:85818695-85818717 ATCTATTTATTTATTTAAGACGG + Intergenic
1086691934 11:89797272-89797294 ATATTTTACTTTATGTATGTTGG + Intergenic
1086713867 11:90042386-90042408 ATATTTTACTTTATGTATGTTGG - Intergenic
1086758632 11:90598060-90598082 AGCTTTTGCTTTATGTATTTTGG - Intergenic
1087333888 11:96818277-96818299 TTGTATTACTTTGTGTAAGTGGG + Intergenic
1089805023 11:121079210-121079232 ATCTATGGCTTCAGGTAAGTAGG + Intronic
1090551490 11:127825026-127825048 AGCTCCTGCTTTATGTAACTTGG + Intergenic
1093219749 12:16405753-16405775 ATTTATTGATTTGTGTATGTTGG - Intronic
1094020964 12:25913737-25913759 ATCAAGTGCTTTATGTGACTTGG + Intergenic
1094316884 12:29145345-29145367 ACCTCTTGCTTTATGCAAATGGG + Intergenic
1094479192 12:30867511-30867533 AACTGTTGATTTTTGTAAGTTGG + Intergenic
1094734497 12:33219305-33219327 ATTTATTGATTTGTGTATGTTGG + Intergenic
1094785366 12:33842360-33842382 ATCATTTGCTTTTTGTTAGTAGG + Intergenic
1095310931 12:40695551-40695573 ATCTATTTCTACATGTAAATTGG + Intronic
1096048948 12:48589286-48589308 ATTTATTTATTTATGTATGTTGG - Intergenic
1097860269 12:64511965-64511987 GTCTATTGCTTCTTGTAAGGAGG + Intergenic
1099125653 12:78753528-78753550 ATATCTTGCTTAATGTCAGTAGG + Intergenic
1099561914 12:84189617-84189639 ATTTATTGATTTGTGTATGTTGG - Intergenic
1101554235 12:105792765-105792787 ATCTATTTCTTAATCTGAGTGGG + Intergenic
1101783175 12:107856206-107856228 ATATATTGCTTTAAGTATTTAGG + Intergenic
1103877270 12:124137941-124137963 ATCTAGTTCTTTAGGTAAGAAGG - Intronic
1104535005 12:129610488-129610510 TTTTAATGCTTTATGGAAGTAGG - Intronic
1104871724 12:132003638-132003660 ATATGATGCTATATGTAAGTAGG - Intronic
1107084285 13:36408973-36408995 ATATATTACTTTTTGTAACTTGG + Intergenic
1109688043 13:65846027-65846049 ATCAATTGCATAATGTAAGCAGG - Intergenic
1110244376 13:73305441-73305463 ATCTATTGCTTTATGTAAGTGGG + Intergenic
1110952096 13:81507651-81507673 ATCAATTTCTTTTTGGAAGTGGG + Intergenic
1111835405 13:93382846-93382868 AAATATTGCTTTAGGGAAGTAGG - Intronic
1113106427 13:106776264-106776286 ATTTATTGGCTTATGTAAATTGG - Intergenic
1113289825 13:108892821-108892843 CTCTATTACCTTATGTAAATTGG + Intronic
1113605101 13:111599413-111599435 ATCTATTTCATTATGTTATTAGG - Intronic
1116434934 14:44886357-44886379 ATTTATTGGTTCATATAAGTGGG - Intergenic
1117476807 14:56103756-56103778 TTCCATTGCCTAATGTAAGTTGG - Intergenic
1117591589 14:57274693-57274715 ATCTAATGAATTCTGTAAGTTGG - Exonic
1117860006 14:60080047-60080069 ATTTATTGGTTCATGTAATTGGG - Intergenic
1119855086 14:77893599-77893621 ATCTATTGCTTGATGTCATCTGG + Intronic
1120320444 14:82953233-82953255 ATCTTCTACTTTATGTAACTGGG - Intergenic
1120851070 14:89171347-89171369 ATCTATTGCTTAATGTTTGTTGG - Intronic
1120905209 14:89614440-89614462 ATCTTTTTCTGTATGTACGTAGG + Intronic
1121923284 14:97903484-97903506 ATGTATTGAATGATGTAAGTTGG + Intergenic
1122033488 14:98930949-98930971 ATCAATTGCTAAATGTAAGAAGG + Intergenic
1126577170 15:50208645-50208667 ATTTCTTCCTTTGTGTAAGTGGG - Intronic
1127603372 15:60561603-60561625 ATCTATTACATTATGGAAGGGGG - Intronic
1127638896 15:60896870-60896892 CTCTATCACTTTATCTAAGTGGG + Intronic
1128916754 15:71570026-71570048 ATTTATTGAGTTAAGTAAGTTGG + Intronic
1128956976 15:71957638-71957660 TTCTGTTTGTTTATGTAAGTGGG - Intronic
1132388378 15:101419263-101419285 AGCTATTGATTTTTGTATGTTGG - Intronic
1133703684 16:8333165-8333187 ACCTACTGCTTTATGTCACTGGG + Intergenic
1138645725 16:58423056-58423078 ATGTAGTCCTTTATGTAGGTTGG + Intergenic
1138883448 16:61045841-61045863 ATCTATTGCTTTATGTGTAAAGG + Intergenic
1138883572 16:61047447-61047469 ATCTATTGCTTTATATATAAAGG - Intergenic
1139231235 16:65284558-65284580 CTCTCTTGTTTCATGTAAGTCGG + Intergenic
1140778416 16:78272129-78272151 ATCTTGTGATTTCTGTAAGTTGG + Intronic
1141055159 16:80807001-80807023 ATCGAATGCTTCATGGAAGTAGG - Intergenic
1141219516 16:82056204-82056226 ATCTAAGGTTTTATCTAAGTAGG - Intronic
1142553618 17:756673-756695 CTCTATTGCTTTATATAAAGAGG + Intergenic
1142728370 17:1832761-1832783 ATCTATTGCATAAGGTAAGTAGG + Intronic
1147059884 17:37867035-37867057 ATTTATTTCTTTATTTCAGTAGG - Intergenic
1149394290 17:56223319-56223341 TTCTTTTACTTTATTTAAGTGGG + Intronic
1153218646 18:2843575-2843597 AATTTTTGCTTTAGGTAAGTTGG + Intergenic
1156569242 18:38233864-38233886 ATGTAATGCTTTAAGTAAGGAGG + Intergenic
1156855118 18:41772864-41772886 TTAGATTGCTTTATGGAAGTAGG + Intergenic
1157270143 18:46268226-46268248 AGCTAGTGCTTTATGTCATTTGG + Intergenic
1157752111 18:50188513-50188535 ATGTGATGCTTTATCTAAGTAGG - Intronic
1158223282 18:55171592-55171614 ATCTGTTGATTTATTTCAGTGGG - Intergenic
1159324530 18:66897232-66897254 ATTTATTGCTTTATGTTTTTTGG - Intergenic
1164326364 19:24195976-24195998 AGTTAATGCCTTATGTAAGTTGG + Intergenic
930557460 2:52916742-52916764 AACTATTGCTTTATGTTTTTGGG + Intergenic
932380038 2:71274088-71274110 ATTTATTGTTTTTTGTATGTTGG - Intergenic
933434247 2:82225833-82225855 ATGTAATGTATTATGTAAGTTGG + Intergenic
933484544 2:82902253-82902275 ATGTAGTGCTTCATGGAAGTAGG - Intergenic
933554775 2:83818631-83818653 ATTTATTGATTTGTGTATGTTGG + Intergenic
935075428 2:99738717-99738739 ATTTATGGCTCTTTGTAAGTGGG + Intronic
935648242 2:105359848-105359870 ATCTTTCACTTTATGGAAGTCGG + Intronic
936842895 2:116795080-116795102 ATCTGTTACTTTATGTCAGAGGG + Intergenic
937331943 2:121037051-121037073 AGCCATTGCTTTGTGTATGTTGG - Intergenic
940128162 2:150350958-150350980 ATCTATTTATTTATATAAATAGG + Intergenic
941264718 2:163347350-163347372 ATGTATTTCTTTATGTACTTGGG - Intergenic
943555909 2:189403717-189403739 AATTATTGATTTATGTATGTTGG + Intergenic
943813826 2:192225671-192225693 GTCTATTGCTTTGTGTTTGTTGG - Intergenic
943943852 2:194033210-194033232 TTCTATTGCTTTGTGTACATTGG - Intergenic
946477802 2:220025415-220025437 ATCTATTGCATCATCTCAGTGGG - Intergenic
947081507 2:226402273-226402295 ATCTATTGTTTTTAGTAATTAGG - Intergenic
947449692 2:230195885-230195907 ATCTTTTGCTTTATCTAATAAGG - Intronic
948192752 2:236072616-236072638 ATTTATTTATTTATGTAGGTAGG + Intronic
948724624 2:239926607-239926629 ATCTATTTTTTTTTATAAGTAGG - Intronic
1170244123 20:14202683-14202705 ATCCATTGCTTTCTGCAACTAGG - Intronic
1170264803 20:14453553-14453575 ATCAAATGCTTTAAGTACGTGGG + Intronic
1171150436 20:22822487-22822509 AGCTATTCTTTTATGCAAGTAGG + Intergenic
1175049835 20:56144999-56145021 TTCTATTCCTTTATGAAAGAGGG + Intergenic
1176992649 21:15517406-15517428 ATCTGTAGCTTTATGGTAGTGGG + Intergenic
1178203622 21:30437661-30437683 ATAAATTGCTTTATGTATTTTGG + Intergenic
1178948719 21:36968406-36968428 ATCTATCGCTATATGCAAGGGGG - Intronic
1180038563 21:45263930-45263952 ATAAACTGCTTTATGGAAGTTGG - Exonic
1180202305 21:46231738-46231760 TTTTATTACTTTATGTGAGTAGG - Intergenic
1182817367 22:33177342-33177364 ATCTATTGTTTTATTTAATAAGG - Intronic
951294617 3:20918388-20918410 ATGTTTTGATTTATTTAAGTTGG - Intergenic
951863835 3:27284741-27284763 ATCTTTGGCTATATGTATGTTGG - Intronic
952871553 3:37905504-37905526 AGCTATTTCTGTATGTAAGTAGG + Intronic
955036257 3:55270783-55270805 ATCTATAGCTAAATGTAACTTGG + Intergenic
956348655 3:68309885-68309907 ATATATTCCTTTATGTCAGTGGG + Intronic
957091944 3:75739499-75739521 ATTTATTACATTATGTCAGTAGG - Intronic
957536291 3:81508170-81508192 ACCTATTTCTCTATGTAAATAGG + Intronic
957760693 3:84552234-84552256 GTATATGGCTTTTTGTAAGTAGG - Intergenic
959644991 3:108689308-108689330 ATCTTATGCTTTATGAAAGGGGG - Intronic
960194508 3:114748897-114748919 ATTTAGTGCTTTATTAAAGTGGG - Intronic
962570751 3:136711042-136711064 ATATTTTTCTTTTTGTAAGTGGG - Intronic
962661412 3:137604277-137604299 ATCTATTCCTAGATGTAAGGGGG - Intergenic
963876146 3:150477386-150477408 AACTTTTGCTTTATGTATTTAGG + Intergenic
964256544 3:154780987-154781009 ATATATTCCTTTTTGTAACTTGG + Intergenic
965052875 3:163673143-163673165 ATCTTTTCCTTTGTGTAAGCTGG + Intergenic
965403739 3:168245867-168245889 ATTTAATGCTTTATGTATGCTGG - Intergenic
966133921 3:176676663-176676685 ATTTATTGATTTGTGTATGTTGG - Intergenic
966352760 3:179047893-179047915 ATTTTTTGATTTATTTAAGTTGG - Intronic
966439781 3:179931067-179931089 ATTTATTTCTGTATGTGAGTGGG - Intronic
967054625 3:185820463-185820485 ATTTATTTCTCTTTGTAAGTTGG - Intronic
968154581 3:196369248-196369270 ATCTATTGATGTATGTATTTAGG - Intronic
971177963 4:24299423-24299445 ATATATTGACTTCTGTAAGTAGG - Intergenic
971273047 4:25169365-25169387 ATTTTTTGCTTTATGTATTTTGG - Intronic
973716723 4:53684250-53684272 GTTTATTGCTTTATGTATGTAGG - Intronic
973973148 4:56235200-56235222 ATATATTGCTTTATGGCATTTGG - Intronic
974410805 4:61539140-61539162 AGCTAGTGCTTTATGTAGGGAGG + Intronic
974513937 4:62883177-62883199 ATCACATGCTTTTTGTAAGTAGG - Intergenic
976691573 4:87873108-87873130 ATCTATAGCTTTAGGTAAGATGG - Intergenic
978181087 4:105796776-105796798 ATCTGTAGCTTTTTGAAAGTTGG - Intronic
979518783 4:121642161-121642183 TTCTATTGTTTTATGAATGTTGG + Intergenic
984066639 4:175055783-175055805 ATTTATTTATTTATTTAAGTTGG - Intergenic
984337525 4:178412124-178412146 AGTTTTTGCTTTATGTAATTTGG - Intergenic
984933761 4:184871780-184871802 ATTTATTTCTTTCTGTGAGTAGG - Intergenic
986603491 5:9498007-9498029 ATCTGATCCTGTATGTAAGTGGG + Intronic
989669809 5:43902587-43902609 TCCTATTGCTTTATGTACATTGG - Intergenic
989808026 5:45636325-45636347 TACTATTGGTTTATGAAAGTTGG - Intronic
990016622 5:51070741-51070763 ATCTATTTCTTGTTGAAAGTAGG + Intergenic
993342733 5:86744390-86744412 ATCTATAGCTTGATGTTTGTCGG + Intergenic
994004252 5:94819046-94819068 TTATCTTGCTTTATGTAACTGGG - Intronic
994062101 5:95490060-95490082 ATCTATTTATTAATTTAAGTAGG + Intronic
994852192 5:105070207-105070229 ATGTATTACCTTATGTAACTAGG + Intergenic
996686617 5:126288701-126288723 AGCTTTTGCTTTATGTATTTTGG - Intergenic
996790497 5:127289273-127289295 ATATTTTGCTTTATGAAACTTGG - Intergenic
997270670 5:132534962-132534984 ACCTATTGCTGAATATAAGTAGG + Intergenic
997393643 5:133538642-133538664 ATTTATTCATTTATGTATGTAGG + Intronic
998711053 5:144825646-144825668 ATTTATTGATTTGTGTATGTTGG + Intergenic
999222664 5:149994099-149994121 GTATATTGCTTTATTTAAATTGG + Exonic
999585059 5:153080924-153080946 AACTATTGCATTGTGTGAGTTGG - Intergenic
1000649590 5:163800825-163800847 ATTTATTGCCTGTTGTAAGTAGG + Intergenic
1001355167 5:171014206-171014228 ATCTATGTCTTTATATAAATAGG + Intronic
1002341882 5:178522232-178522254 ATGTTTTGCTTTATGTAATTTGG + Intronic
1002951980 6:1822930-1822952 TTCTATTGCATTTTGTAATTTGG - Intronic
1003360899 6:5424091-5424113 AACTGTTGCTTTATCTAAGTGGG + Intronic
1004571271 6:16847868-16847890 TTCTATTACTGTATGTGAGTGGG - Intergenic
1005194741 6:23269990-23270012 ATCTATTGCTAGATGAAGGTAGG - Intergenic
1008567334 6:52782495-52782517 ATTTATTCCTTGATGTATGTGGG - Intergenic
1008573671 6:52838905-52838927 ATTTATTACTTGATGTATGTGGG - Intronic
1008576790 6:52868691-52868713 ATTTATTACTTGATGTATGTGGG - Intronic
1009282069 6:61764883-61764905 ATCTGTTGGTTCATGTTAGTAGG + Intronic
1009338552 6:62525155-62525177 ATCTGTTTCTTGATCTAAGTAGG + Intergenic
1009679066 6:66868440-66868462 ATGTATTGCTGCATGTCAGTTGG - Intergenic
1010098178 6:72071767-72071789 ATCTATTCCATTATGAAAGTAGG - Intronic
1010546370 6:77161814-77161836 ATTTATTTCTTTATATAGGTAGG + Intergenic
1013384718 6:109614990-109615012 ATCTATTGCTATATTCCAGTGGG + Intronic
1014420789 6:121243116-121243138 CTCTATTGCTTTGTGTTAGATGG - Intronic
1014507462 6:122277477-122277499 ATCTACTACTTTATAAAAGTAGG - Intergenic
1014507463 6:122277504-122277526 ATCTACTACTTTATAAAAGTAGG - Intergenic
1016248431 6:142015548-142015570 ATCTTCACCTTTATGTAAGTTGG - Intergenic
1016501962 6:144731256-144731278 ATATATTGCTATTTGTTAGTAGG - Intronic
1020388842 7:7636524-7636546 ATCTACTTCATTTTGTAAGTAGG + Exonic
1021907807 7:25352984-25353006 ATCAAATGCTTTATGTCAGCAGG + Intergenic
1022231374 7:28416452-28416474 ATCTTCTCCTTTAAGTAAGTTGG + Intronic
1022758096 7:33316182-33316204 TTCTAAAACTTTATGTAAGTGGG + Intronic
1022874080 7:34510307-34510329 ATCTATTTATTTATTTCAGTTGG - Intergenic
1023461229 7:40399410-40399432 ATTTATTGTTTTATGTAACTAGG + Intronic
1025222476 7:57126375-57126397 ATCTTTTGCTCTAGGTTAGTGGG - Intronic
1025621731 7:63179068-63179090 ATTTATTGCTCTGGGTAAGTAGG + Intergenic
1025633264 7:63298049-63298071 ATCTTTTGCTCTAGGTTAGTGGG - Intergenic
1025649432 7:63450140-63450162 ATCTTTTGCTCTAGGTTAGTGGG + Intergenic
1026812521 7:73480540-73480562 AACTGTTGCTTTATGTGATTAGG + Intronic
1027725295 7:81797743-81797765 ATTTATTTATTTATGTAGGTAGG + Intergenic
1028041005 7:86054479-86054501 ATTTATTGATTTGTGTATGTTGG + Intergenic
1028221886 7:88207065-88207087 ATCTATTGCTTTATGTTTAGCGG - Intronic
1028581459 7:92413616-92413638 ATTTATTGCTTCTTGTAAGAGGG + Intergenic
1028822165 7:95224800-95224822 ATCTATTCCTTTGAGTAAATAGG - Intronic
1028836760 7:95383043-95383065 ATTTATTGATTTGTGTATGTTGG - Intronic
1030334036 7:108304522-108304544 ATCTATTGCTTGTTATAAATAGG - Intronic
1031722894 7:125199601-125199623 ATCTATTTGTTTATGAAAGCTGG - Intergenic
1032630531 7:133645925-133645947 CTTTATTGCTTTATGTTAGCTGG + Intronic
1032691719 7:134294148-134294170 ATCCATTGCTTTCTGTGATTAGG - Exonic
1033804914 7:144942998-144943020 ATATTGTGCTTTATGTATGTGGG + Intergenic
1033876131 7:145821004-145821026 ATCTATTTCTTGTTGAAAGTGGG + Intergenic
1035949945 8:4009170-4009192 ATCTATTTATTTCTGTAGGTTGG + Intronic
1040985579 8:53290676-53290698 ATTGATTGGTTAATGTAAGTGGG + Intergenic
1042488641 8:69374807-69374829 ATTTATTTATTTATGTAATTGGG - Intergenic
1043064536 8:75550841-75550863 ATCTTTTGCTTTATTAATGTTGG + Intronic
1043220991 8:77663458-77663480 ATCTCTTTCTTCATGTCAGTTGG - Intergenic
1043649420 8:82571392-82571414 ATCTATTTTTATATGTAATTTGG - Intergenic
1044766134 8:95576773-95576795 AGATATTGCTTTATGTATTTTGG - Intergenic
1047332626 8:123905907-123905929 CCGTATTGCTTTATGTAAGTAGG - Intronic
1050680617 9:8107049-8107071 TTTTATTGCCTTATGTTAGTGGG + Intergenic
1055818402 9:80233390-80233412 AGCAATTGCTTCATGTAATTTGG + Intergenic
1056121731 9:83494931-83494953 ATCTTTTGTTTTATTAAAGTAGG - Intronic
1056478184 9:86973493-86973515 ATCTAATGGTTTATGTATATTGG - Intergenic
1059974720 9:119703160-119703182 AGCTATTGGTTTAGGTAAGTAGG + Intergenic
1187005282 X:15226725-15226747 CTCTTTTCCTTTATTTAAGTAGG + Intergenic
1187785012 X:22874430-22874452 ATCTTTTGATTTATGAAAATGGG - Intergenic
1188648346 X:32596915-32596937 ATCTATTGGTTTTTATAAATCGG - Intronic
1189029062 X:37431060-37431082 AACTATTGATATATGTAACTTGG - Intronic
1190359545 X:49636077-49636099 ATCGATTACATTATGTAAGAGGG + Intergenic
1190525560 X:51326249-51326271 ATCTAAGGCCTTATGTAACTTGG - Intergenic
1191811561 X:65194820-65194842 ATTTATTGCTTTATATATCTGGG + Intergenic
1193939660 X:87665781-87665803 ATCTATTGCTCTAAATAAATTGG + Intronic
1193993243 X:88334861-88334883 AGCTAGTGCTTCATGGAAGTTGG - Intergenic
1195873288 X:109509720-109509742 ATCTATTCCTTATTGAAAGTGGG - Intergenic
1196266441 X:113652908-113652930 ATTTTTTGCTTAATATAAGTTGG + Intergenic
1197495388 X:127173324-127173346 GCCTCTTGCTTTATGTAAATGGG + Intergenic