ID: 1110252267

View in Genome Browser
Species Human (GRCh38)
Location 13:73393881-73393903
Sequence GCCACATAGAAACAACAGTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110252266_1110252267 -10 Left 1110252266 13:73393868-73393890 CCAATCAGCTGCTGCCACATAGA No data
Right 1110252267 13:73393881-73393903 GCCACATAGAAACAACAGTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110252267 Original CRISPR GCCACATAGAAACAACAGTA TGG Intergenic
No off target data available for this crispr