ID: 1110253834

View in Genome Browser
Species Human (GRCh38)
Location 13:73409914-73409936
Sequence GAGGGATGATGTTAGTCTAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110253828_1110253834 17 Left 1110253828 13:73409874-73409896 CCTCTGTGAAGGCCTGGGGATGA No data
Right 1110253834 13:73409914-73409936 GAGGGATGATGTTAGTCTAAAGG No data
1110253830_1110253834 5 Left 1110253830 13:73409886-73409908 CCTGGGGATGACAGAGTGTGGCA No data
Right 1110253834 13:73409914-73409936 GAGGGATGATGTTAGTCTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110253834 Original CRISPR GAGGGATGATGTTAGTCTAA AGG Intergenic
No off target data available for this crispr