ID: 1110255547

View in Genome Browser
Species Human (GRCh38)
Location 13:73429881-73429903
Sequence CTGCATGTTCAGACAAGGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110255547_1110255550 27 Left 1110255547 13:73429881-73429903 CCACTCCTTGTCTGAACATGCAG No data
Right 1110255550 13:73429931-73429953 AGACACAATAGAGCTTTCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110255547 Original CRISPR CTGCATGTTCAGACAAGGAG TGG (reversed) Intergenic
No off target data available for this crispr