ID: 1110255550

View in Genome Browser
Species Human (GRCh38)
Location 13:73429931-73429953
Sequence AGACACAATAGAGCTTTCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110255548_1110255550 22 Left 1110255548 13:73429886-73429908 CCTTGTCTGAACATGCAGCAATG No data
Right 1110255550 13:73429931-73429953 AGACACAATAGAGCTTTCCATGG No data
1110255547_1110255550 27 Left 1110255547 13:73429881-73429903 CCACTCCTTGTCTGAACATGCAG No data
Right 1110255550 13:73429931-73429953 AGACACAATAGAGCTTTCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110255550 Original CRISPR AGACACAATAGAGCTTTCCA TGG Intergenic
No off target data available for this crispr