ID: 1110256412

View in Genome Browser
Species Human (GRCh38)
Location 13:73438609-73438631
Sequence CAGAGCTACCACAGTTATGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110256408_1110256412 -7 Left 1110256408 13:73438593-73438615 CCAGGCAGCTTAGCCCCAGAGCT No data
Right 1110256412 13:73438609-73438631 CAGAGCTACCACAGTTATGAAGG No data
1110256407_1110256412 -6 Left 1110256407 13:73438592-73438614 CCCAGGCAGCTTAGCCCCAGAGC No data
Right 1110256412 13:73438609-73438631 CAGAGCTACCACAGTTATGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110256412 Original CRISPR CAGAGCTACCACAGTTATGA AGG Intergenic
No off target data available for this crispr