ID: 1110259427

View in Genome Browser
Species Human (GRCh38)
Location 13:73468496-73468518
Sequence AATGGCATTGAAAACAAAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110259427_1110259431 -1 Left 1110259427 13:73468496-73468518 CCCTTTTTGTTTTCAATGCCATT No data
Right 1110259431 13:73468518-73468540 TAGCACACAAAAATTGAGGAAGG No data
1110259427_1110259430 -5 Left 1110259427 13:73468496-73468518 CCCTTTTTGTTTTCAATGCCATT No data
Right 1110259430 13:73468514-73468536 CCATTAGCACACAAAAATTGAGG No data
1110259427_1110259432 0 Left 1110259427 13:73468496-73468518 CCCTTTTTGTTTTCAATGCCATT No data
Right 1110259432 13:73468519-73468541 AGCACACAAAAATTGAGGAAGGG No data
1110259427_1110259433 14 Left 1110259427 13:73468496-73468518 CCCTTTTTGTTTTCAATGCCATT No data
Right 1110259433 13:73468533-73468555 GAGGAAGGGATTCTATTTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110259427 Original CRISPR AATGGCATTGAAAACAAAAA GGG (reversed) Intergenic
No off target data available for this crispr