ID: 1110259430

View in Genome Browser
Species Human (GRCh38)
Location 13:73468514-73468536
Sequence CCATTAGCACACAAAAATTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110259427_1110259430 -5 Left 1110259427 13:73468496-73468518 CCCTTTTTGTTTTCAATGCCATT No data
Right 1110259430 13:73468514-73468536 CCATTAGCACACAAAAATTGAGG No data
1110259428_1110259430 -6 Left 1110259428 13:73468497-73468519 CCTTTTTGTTTTCAATGCCATTA No data
Right 1110259430 13:73468514-73468536 CCATTAGCACACAAAAATTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110259430 Original CRISPR CCATTAGCACACAAAAATTG AGG Intergenic
No off target data available for this crispr