ID: 1110264599

View in Genome Browser
Species Human (GRCh38)
Location 13:73523063-73523085
Sequence GGCACAGTGAATGCTGGAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110264599_1110264603 -5 Left 1110264599 13:73523063-73523085 CCCACTCCAGCATTCACTGTGCC No data
Right 1110264603 13:73523081-73523103 GTGCCAGGCTGCTGTGTTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110264599 Original CRISPR GGCACAGTGAATGCTGGAGT GGG (reversed) Intergenic
No off target data available for this crispr