ID: 1110264870

View in Genome Browser
Species Human (GRCh38)
Location 13:73525975-73525997
Sequence CCTACGCTTTTGCTTATCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110264870_1110264875 20 Left 1110264870 13:73525975-73525997 CCTGGGATAAGCAAAAGCGTAGG No data
Right 1110264875 13:73526018-73526040 AGTCCCATGGATTGGAAGCATGG No data
1110264870_1110264876 21 Left 1110264870 13:73525975-73525997 CCTGGGATAAGCAAAAGCGTAGG No data
Right 1110264876 13:73526019-73526041 GTCCCATGGATTGGAAGCATGGG No data
1110264870_1110264877 22 Left 1110264870 13:73525975-73525997 CCTGGGATAAGCAAAAGCGTAGG No data
Right 1110264877 13:73526020-73526042 TCCCATGGATTGGAAGCATGGGG No data
1110264870_1110264874 12 Left 1110264870 13:73525975-73525997 CCTGGGATAAGCAAAAGCGTAGG No data
Right 1110264874 13:73526010-73526032 TACTAGTGAGTCCCATGGATTGG No data
1110264870_1110264880 25 Left 1110264870 13:73525975-73525997 CCTGGGATAAGCAAAAGCGTAGG No data
Right 1110264880 13:73526023-73526045 CATGGATTGGAAGCATGGGGAGG No data
1110264870_1110264881 26 Left 1110264870 13:73525975-73525997 CCTGGGATAAGCAAAAGCGTAGG No data
Right 1110264881 13:73526024-73526046 ATGGATTGGAAGCATGGGGAGGG No data
1110264870_1110264873 7 Left 1110264870 13:73525975-73525997 CCTGGGATAAGCAAAAGCGTAGG No data
Right 1110264873 13:73526005-73526027 GAACATACTAGTGAGTCCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110264870 Original CRISPR CCTACGCTTTTGCTTATCCC AGG (reversed) Intergenic
No off target data available for this crispr