ID: 1110264881

View in Genome Browser
Species Human (GRCh38)
Location 13:73526024-73526046
Sequence ATGGATTGGAAGCATGGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110264870_1110264881 26 Left 1110264870 13:73525975-73525997 CCTGGGATAAGCAAAAGCGTAGG No data
Right 1110264881 13:73526024-73526046 ATGGATTGGAAGCATGGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110264881 Original CRISPR ATGGATTGGAAGCATGGGGA GGG Intergenic
No off target data available for this crispr