ID: 1110266179

View in Genome Browser
Species Human (GRCh38)
Location 13:73540435-73540457
Sequence CCGCTAGCTGAATTTTAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110266176_1110266179 9 Left 1110266176 13:73540403-73540425 CCAACTTTGTCTTCTTTGGTAAA No data
Right 1110266179 13:73540435-73540457 CCGCTAGCTGAATTTTAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110266179 Original CRISPR CCGCTAGCTGAATTTTAAGC TGG Intergenic
No off target data available for this crispr