ID: 1110274885

View in Genome Browser
Species Human (GRCh38)
Location 13:73632321-73632343
Sequence CTCCATATAGGCACATAAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110274885_1110274892 24 Left 1110274885 13:73632321-73632343 CCTCTTTATGTGCCTATATGGAG No data
Right 1110274892 13:73632368-73632390 CTCCTAGACCCAGGCGTGCAGGG No data
1110274885_1110274889 15 Left 1110274885 13:73632321-73632343 CCTCTTTATGTGCCTATATGGAG No data
Right 1110274889 13:73632359-73632381 TCAGTACCACTCCTAGACCCAGG No data
1110274885_1110274891 23 Left 1110274885 13:73632321-73632343 CCTCTTTATGTGCCTATATGGAG No data
Right 1110274891 13:73632367-73632389 ACTCCTAGACCCAGGCGTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110274885 Original CRISPR CTCCATATAGGCACATAAAG AGG (reversed) Intergenic
No off target data available for this crispr