ID: 1110274889

View in Genome Browser
Species Human (GRCh38)
Location 13:73632359-73632381
Sequence TCAGTACCACTCCTAGACCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110274886_1110274889 3 Left 1110274886 13:73632333-73632355 CCTATATGGAGAATTGTAACTTC No data
Right 1110274889 13:73632359-73632381 TCAGTACCACTCCTAGACCCAGG No data
1110274883_1110274889 19 Left 1110274883 13:73632317-73632339 CCTTCCTCTTTATGTGCCTATAT No data
Right 1110274889 13:73632359-73632381 TCAGTACCACTCCTAGACCCAGG No data
1110274885_1110274889 15 Left 1110274885 13:73632321-73632343 CCTCTTTATGTGCCTATATGGAG No data
Right 1110274889 13:73632359-73632381 TCAGTACCACTCCTAGACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110274889 Original CRISPR TCAGTACCACTCCTAGACCC AGG Intergenic
No off target data available for this crispr