ID: 1110274898

View in Genome Browser
Species Human (GRCh38)
Location 13:73632419-73632441
Sequence GCCTCAGCTCTGGTGCTGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110274893_1110274898 26 Left 1110274893 13:73632370-73632392 CCTAGACCCAGGCGTGCAGGGTA No data
Right 1110274898 13:73632419-73632441 GCCTCAGCTCTGGTGCTGCCTGG No data
1110274894_1110274898 20 Left 1110274894 13:73632376-73632398 CCCAGGCGTGCAGGGTATCTGTG No data
Right 1110274898 13:73632419-73632441 GCCTCAGCTCTGGTGCTGCCTGG No data
1110274895_1110274898 19 Left 1110274895 13:73632377-73632399 CCAGGCGTGCAGGGTATCTGTGC No data
Right 1110274898 13:73632419-73632441 GCCTCAGCTCTGGTGCTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110274898 Original CRISPR GCCTCAGCTCTGGTGCTGCC TGG Intergenic
No off target data available for this crispr