ID: 1110275306

View in Genome Browser
Species Human (GRCh38)
Location 13:73635602-73635624
Sequence GCAACTAGTCAGACATGAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110275304_1110275306 -1 Left 1110275304 13:73635580-73635602 CCATGTGATCATGTTACAGTAGG No data
Right 1110275306 13:73635602-73635624 GCAACTAGTCAGACATGAGCAGG No data
1110275301_1110275306 30 Left 1110275301 13:73635549-73635571 CCAGATGAGGAATCAGGAGATTG No data
Right 1110275306 13:73635602-73635624 GCAACTAGTCAGACATGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110275306 Original CRISPR GCAACTAGTCAGACATGAGC AGG Intergenic
No off target data available for this crispr