ID: 1110281402

View in Genome Browser
Species Human (GRCh38)
Location 13:73698193-73698215
Sequence GAGGGGAAAGGGAAGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 9497
Summary {0: 1, 1: 13, 2: 164, 3: 1340, 4: 7979}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110281388_1110281402 20 Left 1110281388 13:73698150-73698172 CCGAAAGAAAGAAAGAAAAGAGA 0: 1
1: 6
2: 107
3: 834
4: 5597
Right 1110281402 13:73698193-73698215 GAGGGGAAAGGGAAGGAGGAGGG 0: 1
1: 13
2: 164
3: 1340
4: 7979
1110281387_1110281402 21 Left 1110281387 13:73698149-73698171 CCCGAAAGAAAGAAAGAAAAGAG 0: 1
1: 8
2: 48
3: 436
4: 3073
Right 1110281402 13:73698193-73698215 GAGGGGAAAGGGAAGGAGGAGGG 0: 1
1: 13
2: 164
3: 1340
4: 7979
1110281386_1110281402 22 Left 1110281386 13:73698148-73698170 CCCCGAAAGAAAGAAAGAAAAGA 0: 1
1: 6
2: 68
3: 439
4: 3043
Right 1110281402 13:73698193-73698215 GAGGGGAAAGGGAAGGAGGAGGG 0: 1
1: 13
2: 164
3: 1340
4: 7979

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110281402 Original CRISPR GAGGGGAAAGGGAAGGAGGA GGG Intronic
Too many off-targets to display for this crispr