ID: 1110281554

View in Genome Browser
Species Human (GRCh38)
Location 13:73699559-73699581
Sequence TTTGGTTACCAGGTGAAGTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 130}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110281554_1110281558 1 Left 1110281554 13:73699559-73699581 CCATACTTCACCTGGTAACCAAA 0: 1
1: 0
2: 2
3: 10
4: 130
Right 1110281558 13:73699583-73699605 GTAAGGATTCTACATTACGATGG 0: 1
1: 0
2: 0
3: 2
4: 30

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110281554 Original CRISPR TTTGGTTACCAGGTGAAGTA TGG (reversed) Intronic
903203546 1:21763353-21763375 TTTGGTTCCCACCTGAAGTGTGG - Intronic
904371397 1:30049816-30049838 TCTGGTACCCAGGTGAAGTCAGG + Intergenic
904983629 1:34526805-34526827 TGTGGTTACCAGAAGAAGGAAGG - Intergenic
904995005 1:34624845-34624867 TTTGGTTAGCAGGTGAAGGAAGG + Intergenic
907607692 1:55835044-55835066 AATGGTTACAAGGTGAAGGAAGG - Intergenic
912180549 1:107214146-107214168 TTTGGTAAACAGGTGATGTTTGG + Intronic
912545443 1:110447795-110447817 TTTGGCTGCCAGGTGCAGTGTGG - Intergenic
915956932 1:160228560-160228582 TTAGCTTAGCAGGTGTAGTAGGG + Intronic
919584084 1:199415004-199415026 TTTGTTTATGGGGTGAAGTAGGG - Intergenic
1067421997 10:46159894-46159916 TATTTTTACCAGGTAAAGTAAGG + Intergenic
1067507304 10:46865983-46866005 TATTTTTACCAGGTAAAGTAAGG + Intergenic
1068348318 10:55813061-55813083 TATTTTTACCAGGTAAAGTAAGG - Intergenic
1069311178 10:67039165-67039187 TTTGGTTATAATGTTAAGTATGG - Intronic
1072318269 10:94224220-94224242 TTAGGTTTCCATGTGAAATATGG + Intronic
1074225125 10:111477354-111477376 TTGGGTTATCAGGTAAAATATGG - Intergenic
1075646607 10:124100961-124100983 TTTTGTCACCATGTGAAGAAGGG + Intergenic
1079950972 11:26803958-26803980 TTTGGTTACTGTGTGAAGAATGG - Intergenic
1080519228 11:33052399-33052421 TTTGGTCACAAGGGGAAGTTGGG - Intronic
1088461597 11:110089105-110089127 TTTGGTTACAAAGTTAAGTCTGG - Intergenic
1090632266 11:128660096-128660118 TTTGGGCAGGAGGTGAAGTAGGG + Intergenic
1091070734 11:132560380-132560402 TTTGGGTAACAGGTGATGTTTGG + Intronic
1091975038 12:4817513-4817535 TTAGGGTACCAGGTGAAGCCAGG - Intronic
1092892247 12:12979808-12979830 TTTGGTTACCATGGGAACTGAGG + Intronic
1095370254 12:41458604-41458626 TTTTTTTGCCAGATGAAGTAAGG + Intronic
1098540896 12:71656098-71656120 AGTGGTTACCAGGTGAACTAAGG + Intronic
1099602609 12:84760700-84760722 TCTGGTGACCAGCTGGAGTAAGG + Intergenic
1099933993 12:89104352-89104374 CTTGTTTCCCAGGTGAAGTTTGG + Intergenic
1101484640 12:105141755-105141777 TTTGGTTTCCAGCTGAATTAAGG + Intronic
1102746651 12:115254968-115254990 TTTGGATAACAGGTGAAGAAAGG + Intergenic
1105240014 13:18600039-18600061 TTTGGCCACTAGGTGGAGTATGG + Intergenic
1107278834 13:38709476-38709498 ATTGCTTACCAAGTGATGTATGG + Intronic
1107786224 13:43960743-43960765 TTTGGTTGCTATGTGAAGAATGG + Intergenic
1110108370 13:71709525-71709547 TGTGGTTACCAGATGAACTGTGG + Intronic
1110281554 13:73699559-73699581 TTTGGTTACCAGGTGAAGTATGG - Intronic
1110348009 13:74471038-74471060 TTTGGTTGCCAGTTCAAGTAAGG + Intergenic
1115601503 14:34960051-34960073 TGGTGGTACCAGGTGAAGTAGGG + Intergenic
1115614653 14:35083118-35083140 TTTGGTTATCAAGTGAAGATAGG + Exonic
1117662189 14:58019093-58019115 GGTGGTTACCAGGTGTAGGAGGG + Intronic
1118929892 14:70231785-70231807 TTTGGCTACCAAGTGAAAGACGG + Intergenic
1118954696 14:70469632-70469654 TTTGGCTACCAAGTGAAAGACGG - Intergenic
1120018456 14:79501120-79501142 TTTGATTATCAGGCGAAGTTTGG + Intronic
1121316882 14:92966914-92966936 TTTGTATACGATGTGAAGTAGGG - Intronic
1121725808 14:96148988-96149010 TTTGGCTACGAGGGCAAGTAGGG + Intergenic
1128523135 15:68388775-68388797 TTTGGCTACCATGTGGAGGATGG - Intronic
1130709943 15:86270184-86270206 TTGGGTTGCCAGGTGCAGCAAGG + Intronic
1131146569 15:90017665-90017687 TTTGGTTACTTGGTGAAGGTGGG + Intronic
1133794085 16:9032451-9032473 TTTGCATACGATGTGAAGTAGGG - Intergenic
1136677210 16:31921475-31921497 TCTAGTTACCAGGTGAATTTAGG + Intergenic
1144106709 17:11992669-11992691 TTCCGTTACCAGGTGATGTCTGG - Exonic
1147967917 17:44203814-44203836 TTTGGCTGCCATGTGAAGAATGG + Intergenic
1150174309 17:63034024-63034046 TTGGTTTCCCAGGTGAAGGACGG - Intronic
1151444654 17:74155400-74155422 TTCGGTTGCCAGGTAAAGAATGG + Intergenic
1157195658 18:45618366-45618388 GTTGGTTAGAAGATGAAGTAAGG + Intronic
1165016293 19:32882653-32882675 TTAGGTTACCAGTTGATGCAGGG - Intronic
1165553992 19:36613784-36613806 TTTGTTTATGATGTGAAGTAGGG + Intronic
1165897314 19:39150560-39150582 TTTGGTTGCCCTGTGAAGGACGG - Intronic
930153851 2:48085493-48085515 TGTGGGGAGCAGGTGAAGTAGGG - Intergenic
932384884 2:71323257-71323279 TTTAGTTACCAGGGTAGGTAGGG + Intronic
933005424 2:76987280-76987302 CTTTGTCACCAGGTGAAGTTTGG - Intronic
935072058 2:99703423-99703445 TTTGGATACGATGTGAAGTTTGG + Intronic
935324050 2:101919868-101919890 TTTGCATACCATGTGAGGTAAGG - Intergenic
938940438 2:136164820-136164842 TTTGGTTATTAGATGAAGTGGGG - Intergenic
939248217 2:139652435-139652457 TTTAGTTACCTGGTCAACTATGG + Intergenic
939952267 2:148489530-148489552 CTTGGTCAACAGGTGAAGGATGG + Exonic
940045910 2:149409532-149409554 TTTGGTTACCAGGGCAGGTAGGG + Intronic
940647688 2:156408696-156408718 TTTTTTTACCAGGTGCAGTGGGG - Intergenic
945786897 2:214252161-214252183 TTTGTTTCCCAGGGGCAGTATGG + Intronic
1170237496 20:14123481-14123503 CTAGGTGACCAGGTGAAGCATGG - Intronic
1173507937 20:43603411-43603433 TTTGGTTGCCAGGGGAAGGTAGG + Intronic
1178551820 21:33546861-33546883 TTTGTTTTCCAGTGGAAGTATGG - Intronic
1179311428 21:40199242-40199264 TATGGCTCCCAGGTGATGTAAGG - Intronic
1179607134 21:42523937-42523959 TCTGGTCACCAGCTAAAGTAGGG - Intronic
1181433067 22:22894631-22894653 CATGGCTACCAGGTGAAGTTTGG + Intronic
949115709 3:319678-319700 TTTAGTTTCCAGGTTAACTAAGG + Exonic
954938330 3:54347409-54347431 TTTGGAGACCAGCTGAAGTGGGG + Intronic
955611042 3:60757814-60757836 TTTGGCTGCCATGTGAAGAATGG + Intronic
955737458 3:62054558-62054580 TCTGGCAACCAGGTGAAGTCAGG - Intronic
956042561 3:65160120-65160142 TTTGTATATCATGTGAAGTAGGG + Intergenic
956845442 3:73178182-73178204 TCTGGTAATCAGATGAAGTAGGG - Intergenic
959858913 3:111194465-111194487 CTTGGTGACCAGGTAAAGTAGGG - Intronic
961439128 3:126941910-126941932 TTAGGGTAGCAGGTGAAGTGTGG - Intronic
961872147 3:129996365-129996387 TTTAGTTTCCAGGTGAGGCAGGG + Intergenic
963482001 3:145887746-145887768 CTTAGTTACCAGGTGAATTTAGG - Intergenic
966399383 3:179532872-179532894 AGTGGTTACCAGGGGAAGGAGGG - Intergenic
967350502 3:188509287-188509309 TTTGGAGACCAGGTGAAATAAGG - Intronic
971701388 4:29982195-29982217 TTTGGTGACCAGATAAAGAAGGG + Intergenic
972723720 4:41727174-41727196 TGTGGATACCAGATGAAATATGG - Intergenic
972829514 4:42798784-42798806 TTTGGTTGGTAGGTTAAGTAAGG + Intergenic
980985475 4:139690828-139690850 TCTGGTAACCAGGAGCAGTAAGG - Intronic
982075017 4:151730332-151730354 TTCTGTTACCAGGTTGAGTAGGG - Intronic
984531688 4:180923803-180923825 TTTGGTGAAGAGGTGAAGTTTGG - Intergenic
984996079 4:185431251-185431273 TTTAGTAGCCAGGTGAATTAAGG + Intronic
985875025 5:2587685-2587707 TGTGGTTCCCAGGTGAAGCATGG + Intergenic
986617869 5:9638705-9638727 TTTGGCTACCAGGGAAGGTAGGG + Intronic
987069587 5:14323154-14323176 TTTGGGGACCAGGGGAAGAATGG - Intronic
992660702 5:78958051-78958073 TTTTGTTACCAGATGGAGTGTGG - Intronic
992836857 5:80650213-80650235 TTTGGTAAACAGGTGGGGTAAGG + Intronic
993732604 5:91440376-91440398 TTTGGTCTCCAGGGGAAATAGGG + Intergenic
996326982 5:122286396-122286418 TTTGGCTACCAGGGTAGGTAGGG + Intergenic
997666984 5:135637698-135637720 TTTGGTTACAAGGTGGGTTAGGG + Intergenic
999105196 5:149064424-149064446 TTGGGTGACCAGGTGAAGAATGG + Intergenic
999562470 5:152819719-152819741 TGTGCTTAACAGGAGAAGTAGGG - Intergenic
1001293113 5:170479089-170479111 TTTGGTTACTAAGAGAACTAGGG + Intronic
1004822796 6:19386118-19386140 TTTGGTTACATGATGAAGTCTGG - Intergenic
1005189836 6:23208514-23208536 TTTGTTTTCCAGGTGAACTGAGG - Intergenic
1006554304 6:34852483-34852505 TTTGGATACCAGCTCAACTATGG - Intronic
1007183063 6:39944561-39944583 TTTTGTTGACAGATGAAGTATGG + Intergenic
1007446093 6:41907277-41907299 TTTGGTTCCCAGGTGGAGTATGG - Exonic
1010650569 6:78449887-78449909 TTTGGTTACCTGGAGAAACATGG + Intergenic
1012529946 6:100223195-100223217 TATGGCTACCATGTGAAGAAGGG + Intergenic
1012737848 6:102973797-102973819 TTCAGTTACCAGGGGAGGTAGGG - Intergenic
1014518992 6:122415547-122415569 TGTGGTTACCAAGTGAATTCAGG - Intronic
1014680315 6:124421230-124421252 TTTGGTTACCAGTTACAGTGAGG - Intronic
1020834512 7:13132204-13132226 GTTGGTTAATAGGTGAAGGAGGG + Intergenic
1020867031 7:13578328-13578350 TTTGGTAAGGAGTTGAAGTAGGG + Intergenic
1025886424 7:65598570-65598592 TTTGGATATCAGATGAATTAGGG + Intergenic
1028628855 7:92910480-92910502 TTTTATTACCCAGTGAAGTAAGG - Intergenic
1030974160 7:116100494-116100516 TTTGGTTACCAGCTGGGGTCAGG + Intronic
1031640868 7:124161955-124161977 TTTGGTTTCCAGCTGCAGTGTGG - Intergenic
1037109657 8:15150627-15150649 TTTGGTGTCCAGGTGAAAAAGGG - Intronic
1040428642 8:47315829-47315851 TTTGGGTACCATGTGAGGTAGGG - Intronic
1048493180 8:134913393-134913415 TTTGGTTACTTGGTCATGTAGGG + Intergenic
1048700376 8:137082017-137082039 TCTGGTTACCAGGGGATGCAAGG - Intergenic
1050275313 9:3991546-3991568 ATCGATTACCATGTGAAGTATGG - Intronic
1051558511 9:18412144-18412166 TTTGGTTAACAGGAAAAGTGGGG - Intergenic
1052963094 9:34317699-34317721 TTTGGTTACCAGATCAACTGTGG + Intronic
1058329419 9:103740595-103740617 TAAGGGTACCAGGTGAAGAATGG - Intergenic
1058820038 9:108721467-108721489 TTTGATTAAAAGGTGAAGGAAGG + Intergenic
1059887651 9:118764350-118764372 TTCTGTTACTAGGTGAAGGATGG + Intergenic
1061547385 9:131312628-131312650 TTTGGTTACCAGGGGCAGGCTGG + Intergenic
1186495262 X:10007945-10007967 CTTGATTATGAGGTGAAGTAAGG + Intergenic
1187978109 X:24724795-24724817 TTTGGTTAGAAAGTTAAGTAAGG + Intronic
1188801369 X:34534926-34534948 TTTGTTTATTATGTGAAGTAGGG + Intergenic
1189536743 X:41943121-41943143 TCTGGCTACCAGCAGAAGTATGG - Intergenic
1192359473 X:70429919-70429941 TTTGGCTACCAGATGAAGATCGG + Exonic
1193599367 X:83490435-83490457 TTTTGTGACCATGTGATGTAGGG - Intergenic
1194113099 X:89861468-89861490 TTTGGTTACCAGGATAATGATGG - Intergenic
1198412646 X:136387259-136387281 TTTGGTTAAAAAGTGAAGCAGGG - Intronic
1198928500 X:141825800-141825822 ATTGGTCACCAGGTGATGCAGGG + Intergenic
1200333815 X:155326136-155326158 TTTGGGGAACAGGTGAAGTTTGG - Intronic
1200465748 Y:3516299-3516321 TTTGGTTACCAGGATAATGATGG - Intergenic
1200698458 Y:6381896-6381918 TTTGTTTTGCAGGTGAAGTTTGG + Intergenic
1201035656 Y:9782803-9782825 TTTGTTTTGCAGGTGAAGTTTGG - Intergenic