ID: 1110282722

View in Genome Browser
Species Human (GRCh38)
Location 13:73714197-73714219
Sequence CTCTGAAAGGCCAAGGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 40728
Summary {0: 1, 1: 15, 2: 326, 3: 4700, 4: 35686}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110282716_1110282722 -8 Left 1110282716 13:73714182-73714204 CCTGTAATCCCAGAACTCTGAAA 0: 2
1: 71
2: 2230
3: 38702
4: 343690
Right 1110282722 13:73714197-73714219 CTCTGAAAGGCCAAGGTGGAAGG 0: 1
1: 15
2: 326
3: 4700
4: 35686

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110282722 Original CRISPR CTCTGAAAGGCCAAGGTGGA AGG Intronic
Too many off-targets to display for this crispr