ID: 1110285645

View in Genome Browser
Species Human (GRCh38)
Location 13:73747219-73747241
Sequence CCTTACATGCACACAATTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 90
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 85}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110285641_1110285645 27 Left 1110285641 13:73747169-73747191 CCTTATGGTAGGTGCTGGAGACT 0: 1
1: 0
2: 0
3: 18
4: 142
Right 1110285645 13:73747219-73747241 CCTTACATGCACACAATTGAGGG 0: 1
1: 0
2: 0
3: 4
4: 85

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110285645 Original CRISPR CCTTACATGCACACAATTGA GGG Intronic
902401598 1:16160733-16160755 CCTTAGATGCTCACATTTGATGG + Intergenic
904507405 1:30969425-30969447 TCTCACATGCACACAAAAGATGG + Intronic
906760291 1:48371040-48371062 CCATATATGGCCACAATTGAGGG - Intronic
907930506 1:58994826-58994848 CCTCACATGTACAAAAATGAGGG - Intergenic
915928830 1:160045328-160045350 TCTGTCAGGCACACAATTGATGG - Intronic
917086995 1:171313602-171313624 TCTTACAAGCACACAGTGGAAGG + Intergenic
920848267 1:209611451-209611473 TCTTACATCCACAGGATTGACGG + Exonic
1062931987 10:1359630-1359652 CCTTACAGACACACTATTGCAGG + Intronic
1069496274 10:68906160-68906182 CCTTACCTGAACTCATTTGATGG - Intronic
1069619508 10:69828085-69828107 CTTTACATGCAAATAATTGATGG + Intronic
1071384886 10:85109679-85109701 GCTGACATGCAAATAATTGAAGG - Intergenic
1074245777 10:111690537-111690559 CCTTAAATGTACACAAATAATGG + Intergenic
1074581315 10:114721961-114721983 ACATACATGCACACATTTTAAGG - Intergenic
1081385710 11:42470008-42470030 TATTACAGACACACAATTGAAGG + Intergenic
1084135395 11:67175580-67175602 CCTTACATTCTCCCTATTGAAGG + Intronic
1091830043 12:3542995-3543017 CCATAAGTACACACAATTGAGGG - Intronic
1092990633 12:13895017-13895039 CTTTATATACACACAAATGAGGG - Intronic
1098771909 12:74562856-74562878 TCTTAAACGCACAAAATTGATGG + Intergenic
1104086917 12:125483951-125483973 CCTAACATGAACATAATTGCTGG + Intronic
1105804483 13:23944815-23944837 CCTCACAAGCAGACATTTGAAGG - Intergenic
1110285645 13:73747219-73747241 CCTTACATGCACACAATTGAGGG + Intronic
1110485366 13:76034922-76034944 ACATACATGCATACAATGGAAGG + Intergenic
1110642403 13:77840743-77840765 CCTTACAAGCAAAGAATAGAAGG - Intergenic
1111495382 13:89042219-89042241 CCCTACATGCACAAAATTCTTGG + Intergenic
1111866881 13:93779878-93779900 GTTTATATGCACACAAATGAGGG - Intronic
1115587071 14:34825064-34825086 CCTAAAATTCAGACAATTGATGG - Intronic
1120035725 14:79695427-79695449 CTTTCCATGCACACAACTGCTGG - Intronic
1131316319 15:91340887-91340909 GGCTACAGGCACACAATTGATGG + Intergenic
1142540639 17:656166-656188 CATTTCATGCTCACAACTGAAGG - Intronic
1153329685 18:3861350-3861372 CCTTAAAAGCATAAAATTGATGG - Intronic
1158868749 18:61663470-61663492 CCTTGCAAGCACTCAATTCAAGG + Intergenic
1159708889 18:71728568-71728590 CCTTACATCCACAAGAATGAAGG + Intergenic
1159809505 18:72999460-72999482 CCCTCCATGTACACAACTGAAGG + Intergenic
927000302 2:18787983-18788005 CCTTACCTGCACAGATTTTATGG - Intergenic
931612453 2:64116995-64117017 CCTTATATGGACACAATTCAGGG - Intronic
932655367 2:73606779-73606801 CCTTAATAGGACACAATTGAAGG - Intronic
939825236 2:147007479-147007501 GCTTACATGCACACTATTTTGGG - Intergenic
940511841 2:154625369-154625391 ATATACATGCACAAAATTGAGGG - Intergenic
942553767 2:177149655-177149677 CTTTACATGCACACATTTTCTGG + Intergenic
944941850 2:204636942-204636964 CCTTACAGGGACAGAATTGTTGG - Intronic
947741496 2:232486944-232486966 CCCTCCCTGCACACACTTGAGGG + Intronic
947786297 2:232824034-232824056 CCTTACATGGGCACAGTTCACGG - Intronic
948768607 2:240236057-240236079 TCTTCCATGCTCACAATGGAAGG + Intergenic
1169780592 20:9306077-9306099 CCTTATATGGAGACAATGGAGGG - Intronic
1174948560 20:55016736-55016758 ACTCACATGGACACAATTGTAGG - Intergenic
1181048388 22:20227309-20227331 CTGTACATGCATACAGTTGAGGG - Intergenic
1181718444 22:24753561-24753583 CCTTACAGGGACACAATTTGAGG - Intronic
1181822798 22:25488585-25488607 CCTCATATGCACACATTTGGTGG - Intergenic
955926306 3:64008657-64008679 CCTCACATGCACAATATTGGGGG + Intergenic
958176693 3:90004426-90004448 TCTTATATGCACCCAATTTAAGG + Intergenic
959964464 3:112337349-112337371 CCTTACATAAATACAAGTGAGGG + Intronic
960362498 3:116730804-116730826 TCTAACATGCACACACTTTAGGG - Intronic
960410586 3:117318636-117318658 CCAAACATTCACAAAATTGAAGG + Intergenic
961268617 3:125670837-125670859 CCTAACATTCACATAGTTGAAGG - Intergenic
961492813 3:127266991-127267013 CATTACATGGACACAAGTCAGGG + Intergenic
963786960 3:149544759-149544781 ACTTTCTTGCAAACAATTGAAGG - Intronic
971513398 4:27456029-27456051 CCTTACATGGAGATATTTGAGGG + Intergenic
971901557 4:32665686-32665708 CCTTACTAGCACACAGGTGAAGG - Intergenic
972391047 4:38613958-38613980 CCTTAAATGCCCTGAATTGAGGG + Intergenic
975198473 4:71555192-71555214 ACTTACCTGCACACCATTAAGGG - Exonic
979579860 4:122344937-122344959 GTATACATGCACACAATTCAAGG - Intronic
981986292 4:150861425-150861447 CCTTACGTACACACAATATAAGG - Intronic
982122295 4:152155004-152155026 CCTAACACACACAAAATTGAAGG - Intergenic
984978008 4:185247532-185247554 CCTTACATGCAAACAAAACATGG - Intronic
988304784 5:29480659-29480681 CCTTTCATGGACACAAATCATGG + Intergenic
993185987 5:84620278-84620300 TCTTAAATGCATACAACTGAGGG - Intergenic
995913599 5:117216542-117216564 CTTTACATGTAAACAATTTAAGG + Intergenic
997757943 5:136417792-136417814 CCTTACGTGTTCACAATTGTGGG + Intergenic
998552044 5:143087207-143087229 CCTTACATGCATTCAAATTAAGG + Intronic
1001901703 5:175436379-175436401 CCTCATATGCACATAATTTAGGG + Intergenic
1004240152 6:13913991-13914013 CCTTACAAGCACAAAATGGCTGG - Intergenic
1009712181 6:67338357-67338379 CCTTCCATACACATTATTGAGGG - Intergenic
1015281935 6:131443311-131443333 CCTTAAATGCCCTCAATGGATGG - Intergenic
1015823404 6:137286645-137286667 CCTTAAATGCAGTAAATTGAAGG + Intergenic
1024778514 7:52817480-52817502 TCTTACATTTACACACTTGATGG - Intergenic
1025564290 7:62412977-62412999 CTTTAAATGCACACCATTTAAGG + Intergenic
1026545696 7:71320168-71320190 CTTCTCATGCACACAATTCAGGG - Intronic
1033139025 7:138808719-138808741 CCTTAAATGTAGACAATTAAGGG - Intronic
1033813906 7:145050117-145050139 CCTTTCAGGCACAGAATTCAAGG - Intergenic
1041788331 8:61660666-61660688 CCTTACATGGACAAAAATCATGG - Intronic
1042785277 8:72538192-72538214 ACTCACATGCACACACTTGTGGG + Intronic
1054829153 9:69604370-69604392 GCACACATGCACACACTTGAGGG + Intronic
1057957874 9:99425376-99425398 CCTTACATTCATACACATGAAGG + Intergenic
1058067682 9:100567263-100567285 CCTGCCATGCAAACAATTGGAGG - Intronic
1186066320 X:5769659-5769681 CATAACATGCACACAATAGAGGG - Intergenic
1186332645 X:8551670-8551692 ACTTACATGAAAACAAATGATGG + Intronic
1187662376 X:21563677-21563699 CTTAATATGCACAAAATTGATGG + Intronic
1193862001 X:86680321-86680343 CACTACCTGCACACAATAGATGG - Intronic
1196061190 X:111410073-111410095 CGTTACATTTACACCATTGATGG - Exonic
1198205759 X:134462774-134462796 GCTAACATGCAAACAATTTAAGG - Intronic