ID: 1110286371

View in Genome Browser
Species Human (GRCh38)
Location 13:73754311-73754333
Sequence TTGCATATTGTTCTGGAGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1255
Summary {0: 1, 1: 0, 2: 6, 3: 88, 4: 1160}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110286368_1110286371 6 Left 1110286368 13:73754282-73754304 CCTAACACTCAAAATGAAAACAG 0: 1
1: 0
2: 2
3: 52
4: 461
Right 1110286371 13:73754311-73754333 TTGCATATTGTTCTGGAGACTGG 0: 1
1: 0
2: 6
3: 88
4: 1160

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110286371 Original CRISPR TTGCATATTGTTCTGGAGAC TGG Intronic
900099359 1:954659-954681 TTGTATATTTTTGTAGAGACGGG - Intronic
900909851 1:5587318-5587340 TTTCTTACAGTTCTGGAGACTGG - Intergenic
901048822 1:6415947-6415969 TTCCATATTTTTGTAGAGACGGG + Exonic
901297987 1:8175462-8175484 TTGTATTTTTTTCTAGAGACAGG - Intergenic
901556745 1:10037725-10037747 TTGTATTTTTTTCTAGAGACAGG + Intronic
901591222 1:10345019-10345041 TTGCATTTTTTTGTAGAGACAGG - Intronic
901693263 1:10988141-10988163 TTGCATTCTGTTCAGGAGAGGGG - Intergenic
901856006 1:12044364-12044386 TAGCCTCTAGTTCTGGAGACCGG - Intergenic
901869795 1:12131515-12131537 TTGTTTTTTGTTTTGGAGACAGG + Intronic
901909459 1:12444014-12444036 TTGTATATTTTTTTAGAGACAGG + Intronic
901912234 1:12468859-12468881 TTGTATATTTTTATAGAGACAGG - Intronic
901926396 1:12568752-12568774 TTGTATATTTTTGTAGAGACAGG - Intronic
902364261 1:15960939-15960961 TTGTATTTTTTTCTGGAGATGGG - Intronic
902421083 1:16280766-16280788 TTGTTTTTTTTTCTGGAGACTGG - Intronic
903051448 1:20604262-20604284 TTGCTCACAGTTCTGGAGACTGG + Intronic
903167756 1:21532837-21532859 TGGCATAGGGTTCTGGAGTCAGG + Intronic
903654176 1:24938880-24938902 CTACACATGGTTCTGGAGACTGG - Intronic
903696512 1:25211285-25211307 TTGTATTTTTTGCTGGAGACTGG - Intergenic
903702478 1:25260652-25260674 TTCCTTATAGTTCTGGAGGCTGG + Intronic
903711716 1:25330806-25330828 TTCCTTATAGTTCTGGAGGCTGG + Intronic
903838170 1:26219440-26219462 CTGCAAATTGTTCTGAAGAAAGG + Intergenic
904027221 1:27512105-27512127 CTGCATCTTGATCTGGGGACTGG - Intergenic
904051343 1:27641112-27641134 TTTCTTATAGTTCTGGAGCCTGG - Intergenic
904238996 1:29131971-29131993 TTGTATTTTTTTCTAGAGACAGG + Intergenic
904280287 1:29414041-29414063 TTGCATTGTGTGCTGGAGCCAGG + Intergenic
904449778 1:30603411-30603433 TTGCTTACAGTTCTGGAGGCTGG - Intergenic
904771415 1:32883343-32883365 TTGCATTTTTTTGTAGAGACGGG + Intergenic
904981185 1:34503667-34503689 TTTCTTACTGTTCTGGAGGCTGG + Intergenic
905365784 1:37450656-37450678 TTAAATATTTTTGTGGAGACAGG + Intergenic
905673350 1:39807856-39807878 TTGCATTTTTTGGTGGAGACGGG + Intergenic
905737669 1:40341113-40341135 ATGCATTTTGTTCGTGAGACAGG - Intergenic
905749213 1:40447488-40447510 TTTCTTATAGTTCTGGAGGCTGG - Intergenic
905994173 1:42366605-42366627 TTGCTCATAGTTCTGGAGACTGG - Intergenic
906030851 1:42718910-42718932 TTTCTCATGGTTCTGGAGACTGG + Intergenic
906171599 1:43730740-43730762 TTTAATTTTTTTCTGGAGACAGG + Intronic
906651869 1:47518471-47518493 TTCCTTATGGTTCTGGAGACTGG - Intergenic
906919949 1:50053519-50053541 TTGCATTTTTTTGTAGAGACAGG + Intronic
906965470 1:50452230-50452252 TTGCAAATTGTTCTGTAAAGCGG - Intronic
907175508 1:52518325-52518347 TTTCTCATAGTTCTGGAGACTGG + Intronic
907454092 1:54564232-54564254 TTTCTTTTTCTTCTGGAGACAGG - Intronic
907882912 1:58568026-58568048 TTGTATTTTTTTGTGGAGACAGG - Intergenic
908038455 1:60081575-60081597 TTTCTCATGGTTCTGGAGACCGG - Intergenic
908526675 1:64994443-64994465 TTTCATACAGTTCTGGAGGCTGG + Intergenic
908547901 1:65179827-65179849 TTTCTTTTTGTTTTGGAGACAGG - Intronic
908807436 1:67945803-67945825 TTTCCTATAGTTCTGGAGGCTGG - Intergenic
909213226 1:72850788-72850810 TTTCTTACAGTTCTGGAGACTGG - Intergenic
909481382 1:76131515-76131537 TGGCAGCTTATTCTGGAGACTGG - Intronic
909538213 1:76761902-76761924 TTTCTTATGGTTCTGGAGGCTGG - Intergenic
909721363 1:78774061-78774083 TTTCTTATGGTTCTGGAGGCTGG - Intergenic
909785821 1:79611367-79611389 TTGCATAATGTTTTTGAGCCAGG - Intergenic
910044229 1:82892019-82892041 TTGTATTTTTTTCTAGAGACAGG - Intergenic
910445885 1:87298709-87298731 TTTCTCACTGTTCTGGAGACTGG - Intergenic
910483056 1:87679424-87679446 TTTCTTATGGTTCTGGAGGCTGG - Intergenic
910983517 1:92982060-92982082 TTGCATTTTTTTGTAGAGACAGG + Intergenic
911111936 1:94198303-94198325 TTGTATTTTTTTGTGGAGACTGG - Intronic
911228358 1:95332711-95332733 TTACTTATAGTTCTAGAGACTGG + Intergenic
911246446 1:95523576-95523598 TTGCTTATGGTTCTAGAGGCTGG - Intergenic
911264580 1:95727937-95727959 TTTCATACAGTTCTGGAGGCTGG + Intergenic
911317720 1:96375536-96375558 TTGCTTATAGTTCTGGAGGCTGG - Intergenic
911453555 1:98095758-98095780 TTTCTTATTGTTCTGGAGTCTGG + Intergenic
911631200 1:100185504-100185526 TTGCTCATAGTTCTGGAGGCTGG + Intergenic
911745443 1:101437131-101437153 TTGTATTTTTTTCTAGAGACAGG + Intergenic
912033967 1:105287323-105287345 TTTCTTACAGTTCTGGAGACTGG - Intergenic
912237121 1:107864448-107864470 TTGCATTTTTTTGTAGAGACAGG - Intronic
912268520 1:108185168-108185190 TTTCTTATAGTTCTGGAGGCTGG - Intronic
912355631 1:109052821-109052843 TTGCATTTTTTGGTGGAGACGGG + Intergenic
912548832 1:110471132-110471154 TTGTATTTTTTTCTGGAGACAGG + Intergenic
912666424 1:111584356-111584378 CTGCTAATAGTTCTGGAGACTGG + Intronic
913119302 1:115725237-115725259 TTGCATTTTTTTGTAGAGACAGG + Intronic
913327342 1:117638416-117638438 TTGCTTATTATGCTGGTGACAGG + Intergenic
913994439 1:143640168-143640190 TTGCATTTTTTTTTTGAGACAGG - Intergenic
914315187 1:146504153-146504175 TTGTATATTTTTGTAGAGACAGG - Intergenic
914499167 1:148229223-148229245 TTGTATATTTTTGTAGAGACAGG + Intergenic
915023684 1:152805959-152805981 TTGTAAATGGTTTTGGAGACAGG + Intronic
915651370 1:157313421-157313443 TGGCAGATTGTTCTGGTGGCAGG + Intergenic
916501423 1:165390667-165390689 TTTCTCATAGTTCTGGAGACTGG + Intergenic
916671888 1:167029417-167029439 TTGCATTTTTTGGTGGAGACGGG + Intergenic
917021798 1:170596760-170596782 TTGCATTTTTTTGTAGAGACAGG + Intergenic
917230372 1:172830174-172830196 TGCCATATGGTTCTGGAGGCTGG + Intergenic
917285704 1:173419484-173419506 TTGCTTATAGTTCTGGAGGCTGG - Intergenic
917470596 1:175323034-175323056 GTGCAGATTGTTATGGTGACAGG - Exonic
917554422 1:176069013-176069035 TTGTATTTTTTTGTGGAGACAGG - Intronic
917561860 1:176166762-176166784 TTGTATTTTTTTGTGGAGACGGG - Intronic
917724583 1:177816516-177816538 TTTCTTATAGTTCTGGAGGCTGG - Intergenic
917818560 1:178736725-178736747 TTGCATTTTTTTGTAGAGACAGG - Intronic
917839847 1:178969109-178969131 TTGTATGTTTTTGTGGAGACAGG - Intergenic
918005143 1:180534929-180534951 TTGTATATTTTTGTAGAGACAGG + Intergenic
918217425 1:182404583-182404605 TTTCTTATAGTTGTGGAGACTGG - Intergenic
918413475 1:184284478-184284500 TAGCAAACTGTCCTGGAGACAGG - Intergenic
918985609 1:191621572-191621594 TTTCTTATAGTTCTGGAGACTGG - Intergenic
919004744 1:191882176-191882198 TTCCAGAATGTTCTGGAGTCTGG - Intergenic
919221342 1:194633198-194633220 TTTCTCATAGTTCTGGAGACTGG - Intergenic
919349868 1:196436199-196436221 TTGCATATTCTTTTGGTTACTGG + Intronic
919454620 1:197806487-197806509 TTTCTTATAGTTCTGGAGGCTGG + Intergenic
919583536 1:199407371-199407393 TTGCTTATAGTTCTGGAGACTGG - Intergenic
919700250 1:200624087-200624109 TTGCATTTTTTTGTGGTGACGGG + Intronic
920048645 1:203150157-203150179 CTGCATGTTGTTCTGGGGAGGGG + Intronic
920144035 1:203842423-203842445 TTGCATGTTTTGGTGGAGACGGG - Intronic
920222375 1:204413009-204413031 TTGCATATTTTTATAGAGACAGG + Intergenic
920344478 1:205297320-205297342 TTGCATTTTTTTGTAGAGACAGG + Intergenic
921247906 1:213265098-213265120 TTGCCTATTCTTCAGGAGAAAGG + Intronic
921455586 1:215366823-215366845 TTGCATTTTTTTCCAGAGACAGG + Intergenic
921805632 1:219450974-219450996 TTGCTTATGGTTCTGGAGACTGG - Intergenic
921893280 1:220373685-220373707 TGGCTTATGGTTCTGGAGGCTGG + Intergenic
921952674 1:220946730-220946752 CTCCATATTTTTCTGGAGAGTGG + Intergenic
922066853 1:222152473-222152495 TTTCTTACAGTTCTGGAGACTGG - Intergenic
922228299 1:223664764-223664786 TTACATATTTTTGTAGAGACAGG - Intronic
922386269 1:225087156-225087178 TGGCTTATGGTTCTGGAGGCTGG + Intronic
922539084 1:226405476-226405498 TTGCATTTTTTTGTAGAGACAGG + Intronic
922591175 1:226778384-226778406 TTGCTTATTGTTTTGGAGGAAGG + Intergenic
922859251 1:228801984-228802006 TTGCTCACTGTTCTGGAGGCTGG + Intergenic
922901694 1:229142112-229142134 TTTCTTATAGTTCTGGAGGCAGG + Intergenic
923734755 1:236594969-236594991 TTGTATATTTTTGTAGAGACGGG + Intronic
923842799 1:237692291-237692313 TTGCATATTGGTCTGGGTTCCGG - Intronic
923949748 1:238935891-238935913 TTACATACAGTTCTGGAGGCTGG + Intergenic
924053639 1:240103035-240103057 TTGCATTTTTTTGTAGAGACGGG + Intronic
924400657 1:243676971-243676993 TTGAACATTGTCCTGCAGACAGG - Intronic
924584301 1:245348435-245348457 TTTCTTACAGTTCTGGAGACTGG + Intronic
924796031 1:247292790-247292812 TTGTATTTTGTTGTGGAGACAGG + Intergenic
1062782327 10:225517-225539 TTAAATTTTTTTCTGGAGACAGG + Intronic
1062998133 10:1887964-1887986 GTGCATACTGTTCAGGTGACGGG - Intergenic
1063066483 10:2615103-2615125 TAGCTTATGGTTCTGGAGGCTGG + Intergenic
1063345894 10:5312236-5312258 TTTCTTATGGTTCTGGAGGCTGG + Intergenic
1063807299 10:9660207-9660229 TTGTATTTTTTTCTCGAGACGGG - Intergenic
1063825474 10:9892549-9892571 TTTCTTATAGTTCTGGAGGCTGG + Intergenic
1063838973 10:10048453-10048475 TTTCATATAGCTCTGGAGACTGG - Intergenic
1063867129 10:10377418-10377440 TTGCTTATAGTTCTGGAGCCTGG - Intergenic
1064006926 10:11706219-11706241 TTGCATTTTTTTTTTGAGACAGG - Intergenic
1064016219 10:11774455-11774477 TTTCTTTTTGTTTTGGAGACAGG + Intergenic
1064022310 10:11819327-11819349 TTGTATTTTTTTGTGGAGACGGG + Intergenic
1064219179 10:13425075-13425097 TTTCTCATAGTTCTGGAGACTGG - Intergenic
1064326926 10:14359960-14359982 TTTCTTATAGTTCTGGAGGCTGG + Intronic
1064350671 10:14573413-14573435 TTTCTTATAGTTCTGGAGACTGG - Intronic
1064390708 10:14939515-14939537 TTGCTTAGGGTTCTAGAGACTGG - Intronic
1064465434 10:15575215-15575237 TTGTATTTTTTTCTAGAGACGGG - Intronic
1064767872 10:18693410-18693432 TAGCTCATTGTTCTGGAGGCTGG + Intergenic
1065117763 10:22498847-22498869 TTGCAGAATGTTCTGCACACAGG - Intergenic
1065178198 10:23098884-23098906 TTTCATACGGTTCTGGAGGCTGG + Intronic
1065500963 10:26381989-26382011 TTGCTTACAGTTCTGGAGGCTGG - Intergenic
1065799805 10:29341820-29341842 TTTCCTACAGTTCTGGAGACTGG - Intergenic
1065801218 10:29354481-29354503 TTGCTTACAGTTCTGGAGGCTGG - Intergenic
1065911331 10:30308730-30308752 TTGTATTTTGTTGTAGAGACAGG - Intergenic
1066054561 10:31668393-31668415 TTTCCTATAGTTCTGGAGCCTGG + Intergenic
1066086060 10:31972966-31972988 TTGTATTTTGTTTTAGAGACGGG + Intergenic
1066115362 10:32234098-32234120 TTGCATTTTTTGGTGGAGACGGG - Intergenic
1066232553 10:33451066-33451088 TTGCTGATAGTTCTGGAGGCTGG + Intergenic
1066629747 10:37447436-37447458 TTTCTTATAGTTCTGGAGACTGG - Intergenic
1066644852 10:37595948-37595970 TGGCTTATGGTTCTGGAGTCTGG - Intergenic
1066644881 10:37596250-37596272 TTTCTTATTGTTTTGGAGAATGG + Intergenic
1067007640 10:42680028-42680050 TTGCATTTTTTTGTAGAGACGGG - Intergenic
1067118271 10:43452408-43452430 TTTCTTCTTTTTCTGGAGACAGG + Intronic
1067291014 10:44940768-44940790 TTGTATTTTGTTTTTGAGACAGG + Intergenic
1067364243 10:45610256-45610278 TTTCTTACAGTTCTGGAGACCGG - Intergenic
1067968302 10:50940136-50940158 TTTCTCATTGTTCTGGAGGCTGG - Intergenic
1068288566 10:54971463-54971485 TTTCTTACTGTTCTGGAGACTGG - Intronic
1068510405 10:57958352-57958374 TTCCTTATAGTTCTGGAGGCTGG - Intergenic
1068579031 10:58718185-58718207 TTGCTTCCAGTTCTGGAGACTGG + Intronic
1069138845 10:64799306-64799328 TTTCTCATGGTTCTGGAGACTGG + Intergenic
1069186033 10:65424414-65424436 TTGCATTTTGTTGTAGAGACAGG - Intergenic
1069615433 10:69803319-69803341 TTTCTTATTTTTCTGGAGAAAGG + Intronic
1069630237 10:69893177-69893199 TTGCATTTTTTTGTAGAGACAGG - Intronic
1069732627 10:70628322-70628344 TTGCTCATAGTTCTGGAGGCTGG + Intergenic
1069946534 10:71990213-71990235 TTGCTCATGGTTCTGGAGGCTGG + Intronic
1070020372 10:72579244-72579266 TTGCTTATAGTTCTGGAGGCCGG + Intronic
1070298119 10:75182484-75182506 TTGCTTGTTTTTTTGGAGACAGG - Intergenic
1070364652 10:75724874-75724896 CTGGATTTGGTTCTGGAGACAGG - Intronic
1070403629 10:76075446-76075468 TTTCTTATAGTTCTGGAGTCTGG - Intronic
1070944161 10:80374881-80374903 TTGCATTTTTTTGTAGAGACAGG - Intergenic
1070974109 10:80591361-80591383 TTTCTTATAGTTCTGGAGGCTGG + Intronic
1071412662 10:85412294-85412316 TTTCATACAGTTCTGGAGGCTGG - Intergenic
1072144432 10:92621772-92621794 TTGCATTTTTTTGTAGAGACAGG + Intronic
1072267166 10:93741969-93741991 TTTCTCACTGTTCTGGAGACTGG + Intergenic
1072344846 10:94494714-94494736 TTGTATTTTTTTGTGGAGACAGG + Intronic
1072408704 10:95180373-95180395 TTGTATTTTTTTGTGGAGACTGG - Intergenic
1072471325 10:95716732-95716754 TAGCTCATGGTTCTGGAGACTGG - Intronic
1072548951 10:96462452-96462474 TTTCTTATAGTTCTGGAGGCTGG + Intronic
1072882135 10:99237956-99237978 TTTCACATTGTTCTGGAGAGGGG - Intergenic
1072991902 10:100203921-100203943 TTTCTTATAGTTCTGGAGGCTGG + Intronic
1073313260 10:102559414-102559436 TTGCCTATTGATCAGGACACTGG + Intronic
1073454193 10:103626753-103626775 TTGTATTTTTTTCTAGAGACAGG - Intronic
1073814987 10:107196574-107196596 TTTCTTATAGTTCTGGAGGCTGG - Intergenic
1073879354 10:107961942-107961964 TGGCTTAATGTTCTGGAGACTGG + Intergenic
1075358908 10:121811795-121811817 TTTCATATTTTTTTGGATACAGG - Intronic
1075406615 10:122199754-122199776 TTGCTTACAGTTCTGGAGGCTGG + Intronic
1075602002 10:123776616-123776638 TTGCAGAATGTTCTGGTGAGTGG - Intronic
1075772745 10:124953969-124953991 TTTCTTTTTTTTCTGGAGACAGG + Intronic
1076015900 10:127027578-127027600 TTGCTTTTTGTTTTTGAGACAGG - Intronic
1076179247 10:128393417-128393439 TTGCAAATTGTTCTGTTGATGGG - Intergenic
1078160028 11:8832277-8832299 TTGTATTTTGTACTAGAGACGGG - Intronic
1078200859 11:9181563-9181585 TTGCATTTTTTTGTAGAGACTGG - Intronic
1078599044 11:12714694-12714716 TTGCTCATGGTTCTGGAGGCTGG + Intronic
1078888816 11:15534982-15535004 TTGCTTTTTGTTATAGAGACAGG + Intergenic
1078949150 11:16109204-16109226 TTTCATTTTGTTTTTGAGACAGG + Intronic
1079299518 11:19265399-19265421 TTGTATTTTTTTGTGGAGACAGG + Intergenic
1079403358 11:20124736-20124758 TTGGTTTTTGTTTTGGAGACTGG + Intergenic
1079740354 11:24051044-24051066 TTTCACATGGTTCTGGAGGCTGG - Intergenic
1080659168 11:34282049-34282071 TCTCTTATGGTTCTGGAGACTGG + Intronic
1080766388 11:35301164-35301186 TTTCTTATGGTTCTGGAGGCTGG - Intronic
1080878038 11:36294564-36294586 TTGCTCATAGTTCTGGAGGCTGG + Intergenic
1081011446 11:37817853-37817875 TTGTATTTTGTTGTAGAGACAGG + Intergenic
1082221120 11:49638477-49638499 TTGCATTTTTTAATGGAGACAGG + Intergenic
1082689746 11:56285521-56285543 GTGTATACTGTTCTGGAGATGGG + Intergenic
1082781075 11:57287820-57287842 TTTCTTATGGTTCTGGAGGCTGG - Intergenic
1082871135 11:57944458-57944480 TTGCATTTTTTGGTGGAGACGGG - Intergenic
1082931592 11:58613201-58613223 TAGCTTGTGGTTCTGGAGACTGG + Intronic
1083037055 11:59648354-59648376 TTTTATATTTTTCTAGAGACAGG + Intronic
1083564492 11:63701771-63701793 TTTTATTTTTTTCTGGAGACAGG - Intronic
1084078344 11:66799906-66799928 TTGCATTTTTTTGTAGAGACAGG - Intronic
1085007173 11:73102787-73102809 TGGCTTATAGTTCTGGAGGCTGG - Intronic
1085446042 11:76601615-76601637 TTGCTCATGGTTCTGGAGTCTGG - Intergenic
1086129996 11:83391247-83391269 TTTCCTATAGTTCTGGAGGCTGG - Intergenic
1086448124 11:86889377-86889399 TTTCTTATAGTTCTGGAGGCTGG + Intronic
1086488498 11:87334184-87334206 TGGCTTATGGTTCTGGAGGCTGG - Intergenic
1086527662 11:87747702-87747724 TTGCATTTTTTTTTTGAGACAGG + Intergenic
1086899826 11:92354432-92354454 TTTAATATTGATATGGAGACTGG + Exonic
1086904395 11:92402556-92402578 TTGTATTTTTTTGTGGAGACAGG - Intronic
1086942619 11:92814121-92814143 TTGCTCATAGTTCTGGAGGCTGG - Intronic
1086972466 11:93098333-93098355 TGGCTCATGGTTCTGGAGACTGG - Intergenic
1087218382 11:95519292-95519314 TTGCAGAGTGTTCTTGAGATGGG + Intergenic
1087799038 11:102484093-102484115 TTGCATATTTTTGTGGAGATGGG - Intronic
1087923136 11:103889953-103889975 TTTCTCATGGTTCTGGAGACTGG + Intergenic
1088277484 11:108102811-108102833 ATGCCTTTTGTTTTGGAGACAGG + Intronic
1089132149 11:116220569-116220591 TTTCTTATGGTTCTGGAGGCTGG - Intergenic
1089393999 11:118123042-118123064 TTGCTCACAGTTCTGGAGACTGG - Intergenic
1089510288 11:118992342-118992364 TTGCATTTTTTGGTGGAGACAGG - Intergenic
1089597198 11:119588054-119588076 TGGCTTATGGTTCTGGAGGCTGG - Intergenic
1090108080 11:123873324-123873346 TTGCAGATTTTTTTGGAAACCGG + Intergenic
1090332078 11:125940140-125940162 TTTCTTACAGTTCTGGAGACTGG - Intergenic
1090364012 11:126191389-126191411 TTGCTCATGGTTCTGGAGGCTGG - Intergenic
1090644417 11:128756215-128756237 TTGCTCAGAGTTCTGGAGACTGG + Intronic
1090686550 11:129128754-129128776 TTGCATTTTTTGGTGGAGACGGG + Intronic
1090781763 11:130013208-130013230 TTAAAAATTGTTCTAGAGACAGG - Intergenic
1090877960 11:130807738-130807760 TTGCTGATAGTTCTGGAGGCGGG + Intergenic
1091451435 12:574676-574698 TGGCTCATGGTTCTGGAGACTGG - Intronic
1091539432 12:1445918-1445940 TTGCTTTCTGTTCTGGAGGCTGG + Intronic
1091726864 12:2852537-2852559 TTTGATATTTTTGTGGAGACGGG + Intronic
1092162101 12:6321191-6321213 TTGCATCTTTTTGTGGAGACAGG + Intronic
1092188892 12:6503334-6503356 TCACATTTTTTTCTGGAGACTGG + Intronic
1092384929 12:8028823-8028845 TTTCATATTTTTGTAGAGACGGG + Intergenic
1092722908 12:11459330-11459352 TTGTATTTTTTTGTGGAGACTGG - Intronic
1093075841 12:14757925-14757947 TTGTATATTTTTGTAGAGACAGG - Intergenic
1093241552 12:16682863-16682885 TTGCTCACAGTTCTGGAGACTGG - Intergenic
1093310286 12:17573614-17573636 TTGCACATTGTTGTGGCGAGTGG + Intergenic
1093470923 12:19501461-19501483 TTGCATGTTTTTGTAGAGACAGG - Intronic
1093515596 12:19982859-19982881 TTGCTCACAGTTCTGGAGACTGG - Intergenic
1093631200 12:21411855-21411877 TTGCATTTTTTTGTAGAGACGGG + Intronic
1093754145 12:22833441-22833463 TTGCTCACAGTTCTGGAGACTGG - Intergenic
1093790448 12:23244046-23244068 TTGGCTATGGTTCTGGAGGCTGG - Intergenic
1093917601 12:24823244-24823266 TTGCATTTTTTTGTAGAGACAGG + Intronic
1093934034 12:24982389-24982411 TTGGCCATGGTTCTGGAGACTGG + Intergenic
1094269041 12:28590903-28590925 CTGAATGTTGTTCTTGAGACAGG - Intergenic
1094537993 12:31338978-31339000 TTGTATTTTGTTGTAGAGACGGG - Intergenic
1094647342 12:32338589-32338611 TTGGAAACTGTTCTGGATACTGG - Intronic
1094697966 12:32840468-32840490 TTTCATTTTTTTGTGGAGACAGG + Intronic
1095695727 12:45142200-45142222 TTGCACACAGTTCTAGAGACTGG - Intergenic
1096516535 12:52158858-52158880 TGGCACATGGTTCTGGAGGCTGG + Intergenic
1096592525 12:52670486-52670508 TTGCATATTCTTCAGCAGATAGG - Intergenic
1096919706 12:55071169-55071191 TTTCTTACAGTTCTGGAGACTGG + Intergenic
1097120622 12:56728805-56728827 TTTTATTTTGTTGTGGAGACGGG - Intronic
1097515467 12:60599292-60599314 TTGCTTATGTTTCTGGAGATTGG - Intergenic
1097527303 12:60753277-60753299 CTGCATTTTGATCTGAAGACTGG - Intergenic
1097864879 12:64551568-64551590 ATGCATATTATTTTTGAGACAGG - Intergenic
1098103325 12:67042197-67042219 TGGCTTACAGTTCTGGAGACTGG - Intergenic
1098111137 12:67123068-67123090 TTTCTTATTGTTCTGGAGGCTGG + Intergenic
1098164298 12:67677784-67677806 TTGCATACACTTCTGGAAACTGG + Intergenic
1098233318 12:68394987-68395009 TTTCATATTTTTATAGAGACAGG + Intergenic
1098239251 12:68449744-68449766 TTGCTTACAGTTCTGGAGAGTGG + Intergenic
1098487799 12:71041638-71041660 TTGCATATTGTTCTAGTACCTGG - Intergenic
1099236700 12:80091502-80091524 TTGTATTTTGTTGTAGAGACGGG - Intergenic
1099303019 12:80921258-80921280 TTTCTTATGGTTCTGGAGTCTGG - Intronic
1100233924 12:92638193-92638215 TTGTATATTTTTGTAGAGACAGG - Intergenic
1100288098 12:93186902-93186924 TTGCTCACAGTTCTGGAGACTGG - Intergenic
1100434004 12:94555046-94555068 TTGCCCATAGTTCTGGAGACTGG + Intergenic
1101071046 12:101076385-101076407 TTTCTTACTGGTCTGGAGACTGG - Intronic
1101745743 12:107540146-107540168 TTTCTTATAGTTCTGGAGGCTGG + Intronic
1102125882 12:110480374-110480396 TTTTATATTTTTCTAGAGACGGG + Intronic
1102412148 12:112729355-112729377 TTGCATTTTTTTGTAGAGACAGG + Intronic
1102414337 12:112747413-112747435 TTTCTTATAGTTCTGGAGGCTGG - Intronic
1102486911 12:113264842-113264864 TTGTTTATTTTTTTGGAGACGGG + Intronic
1102528361 12:113528141-113528163 TTGTTTATTTTTGTGGAGACAGG - Intergenic
1102734172 12:115143286-115143308 TTTCTTATGGTTCTGGAGAATGG - Intergenic
1102875105 12:116443153-116443175 TTGCTTACAGTTCTGGAGGCTGG - Intergenic
1103130116 12:118460749-118460771 TTCCTCATAGTTCTGGAGACTGG - Intergenic
1103303847 12:119948746-119948768 TTTCATATTTTTTTAGAGACGGG - Intergenic
1103438213 12:120943340-120943362 TTTCTTATAGTTCTGGAGGCTGG - Intergenic
1104086163 12:125475859-125475881 TTCCATAATGGTCTAGAGACAGG - Intronic
1104356236 12:128089500-128089522 TTGTATTTTGTTGTAGAGACTGG - Intergenic
1104383044 12:128324686-128324708 TTGTATATTTTTGTAGAGACAGG - Intronic
1104392243 12:128400779-128400801 TTGCATTTTTTTGTGGAGATGGG + Intronic
1104411870 12:128564953-128564975 TGGGATATTGTTATGGAGAATGG + Intronic
1105049387 12:133035131-133035153 TTTCTTACAGTTCTGGAGACTGG - Intergenic
1105249838 13:18688593-18688615 TTGCTCATAGTTCTGGAGGCTGG + Intergenic
1105410166 13:20164911-20164933 TTTAATATTTTTGTGGAGACTGG - Intergenic
1105619642 13:22054306-22054328 TTACACATTGTTCAGGAGAGGGG - Intergenic
1105939469 13:25134417-25134439 TGGCTTATGATTCTGGAGACTGG - Intergenic
1106035784 13:26043887-26043909 TTTCTTATTTTTTTGGAGACAGG + Intergenic
1106162202 13:27211823-27211845 TTGTATATTTTTGTAGAGACAGG - Intergenic
1106224571 13:27775254-27775276 TGGCTTATGGTTCTAGAGACTGG + Intergenic
1106266483 13:28114678-28114700 TGGCATTTTGTTTTTGAGACGGG + Intergenic
1106320616 13:28634472-28634494 ATGTATAATTTTCTGGAGACTGG - Intergenic
1106609382 13:31263961-31263983 TTTCTTATAGTTCTGGAGGCTGG + Intronic
1106972080 13:35153393-35153415 TTAATTATTGTTCTGGAGGCAGG - Intronic
1106999339 13:35525737-35525759 TTGCTTATAGTTGTGGAGGCTGG + Intronic
1107148564 13:37086309-37086331 TTGCCTATAGTTCTGGAGGCTGG + Intergenic
1107301757 13:38973406-38973428 TTTCATATAGTTCTGCAGCCTGG + Intronic
1107306810 13:39030597-39030619 TTTTATATTTTTCTAGAGACAGG + Intronic
1107562567 13:41571519-41571541 TTGCATTTTTTGGTGGAGACGGG + Intronic
1107661047 13:42639855-42639877 TAGCTCATTGTTCTGGAGGCTGG + Intergenic
1107783377 13:43928844-43928866 TTGCATTTTTTTGTAGAGACAGG - Intergenic
1108010679 13:46005658-46005680 TTTCATATTTTTGTAGAGACAGG + Intronic
1108397773 13:50007007-50007029 TTGTATTTTTTGCTGGAGACAGG - Intronic
1108440099 13:50443534-50443556 TTGCTTACAGTTCTGGAGACTGG - Intronic
1108516476 13:51207811-51207833 TTTCTTATAGTTCTGGAGGCTGG - Intergenic
1108647352 13:52443580-52443602 TTTCTCATAGTTCTGGAGACTGG - Intronic
1108676715 13:52743424-52743446 TGGCTTATGGTTCTGGAGGCTGG - Intergenic
1109493335 13:63132622-63132644 TTTCTTATGGTTCTGGAGGCTGG - Intergenic
1109861106 13:68200513-68200535 TTTTTCATTGTTCTGGAGACTGG + Intergenic
1109861273 13:68201771-68201793 TTTCTTATAGTTCTGGAGGCTGG + Intergenic
1110252001 13:73390715-73390737 TTTCTTACAGTTCTGGAGACTGG - Intergenic
1110286371 13:73754311-73754333 TTGCATATTGTTCTGGAGACTGG + Intronic
1110323224 13:74183762-74183784 TTGCATTTTTTTGTAGAGACGGG - Intergenic
1110923394 13:81118180-81118202 TTGCATAATTTTTTTGAGACAGG - Intergenic
1110940430 13:81341817-81341839 TTGCATTTTTTTTTAGAGACAGG - Intergenic
1111184465 13:84713758-84713780 TTTCACATGGTTCTGGAGGCTGG - Intergenic
1111414239 13:87917901-87917923 TTGCATTTTTTTGTGGAGACAGG - Intergenic
1111439446 13:88260507-88260529 TTCTTTATAGTTCTGGAGACTGG - Intergenic
1111667544 13:91288169-91288191 TTGCATTTTTTTGTAGAGACAGG + Intergenic
1111779733 13:92707086-92707108 TGTCATATAGTTCTGGAGGCTGG - Intronic
1112262857 13:97893569-97893591 TTGCTCATAGTTCTGGAGGCTGG + Intergenic
1112266789 13:97931817-97931839 TTTCTTACTGTTCTGGAGGCTGG + Intergenic
1112512674 13:100023788-100023810 TTGTATTTTTTTGTGGAGACAGG - Intergenic
1112757335 13:102652202-102652224 TTGCATTTTTTTGTAGAGACAGG - Intronic
1113674557 13:112198447-112198469 TTTCTTATCGTTCTGGAGGCCGG + Intergenic
1113698526 13:112365685-112365707 TTTCCTATAGTTCTGGAGGCTGG - Intergenic
1114263880 14:21059669-21059691 TTGCATTTTTTTGTAGAGACAGG + Intronic
1114578627 14:23736500-23736522 TTGTATTTTTTGCTGGAGACGGG + Intergenic
1115170896 14:30505463-30505485 TTGCATATTTTTGTAGAGATGGG + Intergenic
1115216036 14:31014998-31015020 TTGTATTTTTTTCTAGAGACAGG + Intronic
1115720039 14:36150447-36150469 TTTCTTACTGTTCTGGAGTCTGG - Intergenic
1115736690 14:36339259-36339281 TGGCTTATGGTTCTGGAGGCTGG + Intergenic
1115821818 14:37221210-37221232 TGACTTATGGTTCTGGAGACTGG + Intronic
1116821138 14:49629132-49629154 TTGCATTTTTTTGTAGAGACAGG + Intronic
1117190509 14:53285812-53285834 TTTCTTATAGTTCTGGAGGCTGG + Intergenic
1117257039 14:53988615-53988637 TTTCTTATAGTTCTGGATACTGG + Intergenic
1117559413 14:56921421-56921443 TTTCTTAGAGTTCTGGAGACTGG - Intergenic
1117674403 14:58141041-58141063 TTTCTTACAGTTCTGGAGACTGG - Intronic
1118067297 14:62206177-62206199 TGGCTTATAGTTCTGGAGGCTGG + Intergenic
1118592323 14:67410972-67410994 TTGTATTTTTTTGTGGAGACAGG - Intronic
1118644269 14:67821631-67821653 TTGTATTTTTTTGTGGAGACAGG + Intronic
1118844981 14:69541249-69541271 TTACTTATTTTTTTGGAGACAGG + Intergenic
1119050893 14:71367479-71367501 TTGTATTTTTTACTGGAGACGGG + Intronic
1119139007 14:72247891-72247913 TTTCTTATAGTTCTGGAGGCTGG - Intronic
1119529137 14:75347333-75347355 TGGCATATGGTTCTGGAGGTTGG - Intergenic
1119550220 14:75504554-75504576 TAGTATATAGTTCTGGAGGCTGG + Intergenic
1119561597 14:75594531-75594553 TGGCTTATGGTTCTGGAGGCTGG + Intronic
1119722158 14:76898693-76898715 TTGCATTTTTTGGTGGAGACGGG - Intergenic
1120086672 14:80283249-80283271 TTGCTTATGATTCTGGAGTCTGG - Intronic
1120193879 14:81462964-81462986 TTGCATTTTTTGGTGGAGACGGG - Intergenic
1120228733 14:81819952-81819974 TGGCTTACAGTTCTGGAGACTGG + Intergenic
1120448443 14:84632713-84632735 TTGCTTACAGTTCTGGAGGCTGG - Intergenic
1120757933 14:88261579-88261601 TTGCATTTTTTTGTAGAGACAGG - Intronic
1120824537 14:88943579-88943601 TTGCTCATGGTTCTGGAGGCTGG + Intergenic
1121085925 14:91146042-91146064 TTGTATATTTTTGTAGAGACAGG + Intronic
1121161303 14:91743833-91743855 TTTCCCATAGTTCTGGAGACTGG - Intronic
1121396678 14:93630326-93630348 TTGTATATTTTTGTGGAGAGAGG + Intronic
1121832020 14:97060733-97060755 TTTCTTACTGTTCTGGAGGCTGG - Intergenic
1122650666 14:103224764-103224786 TTGTTTTTTGTTTTGGAGACAGG - Intergenic
1123438231 15:20271458-20271480 TTGCTTTTTTTTTTGGAGACAGG + Intergenic
1123441996 15:20299079-20299101 TTACATATTTTTTTTGAGACAGG + Intergenic
1123769240 15:23512069-23512091 TTTCTTATAGTTCTGGAGGCTGG + Intergenic
1123775624 15:23576305-23576327 TGGCTTATTGTTATGGAGGCTGG + Intronic
1124202179 15:27687846-27687868 TTGCTTACAGTTCTGGAGACTGG + Intergenic
1124202943 15:27693923-27693945 TTTCTTACTGTTCTGGAGGCCGG - Intergenic
1124963011 15:34412194-34412216 TTTCATATTTTTGTAGAGACAGG + Intronic
1124979634 15:34558420-34558442 TTTCATATTTTTGTAGAGACAGG + Intronic
1125036428 15:35129815-35129837 TTGTGAATTGTTCTGCAGACTGG - Intergenic
1125139343 15:36385750-36385772 TTTTATATTGTAGTGGAGACGGG - Intergenic
1125317480 15:38446677-38446699 TTTCTTATAGTTCTGGAGGCTGG + Intergenic
1125396608 15:39255544-39255566 TTTCTCATTGTTCTGGAGGCTGG - Intergenic
1125620047 15:41052499-41052521 TTTCATTTTTTTCTAGAGACAGG - Intronic
1126162725 15:45629217-45629239 TTGCATTTTTTTGTAGAGACAGG + Intronic
1126244006 15:46482022-46482044 TGGCTTATGGTTCTGGAGGCTGG - Intergenic
1126264019 15:46731232-46731254 TTTCTTACAGTTCTGGAGACTGG + Intergenic
1126318448 15:47396164-47396186 TTTCCTATAGTCCTGGAGACTGG - Intronic
1126622736 15:50656303-50656325 TTGTTTTTTTTTCTGGAGACAGG + Intronic
1126755718 15:51923210-51923232 TTGCATTTTTTGGTGGAGACGGG - Intronic
1126853381 15:52813065-52813087 TTGCTCATACTTCTGGAGACTGG - Intergenic
1127046986 15:55036334-55036356 TTGCTTATAATTCTGGAGGCTGG - Intergenic
1127087684 15:55439957-55439979 TTTCTTATAGTTCTGGAGGCTGG - Intronic
1127103640 15:55590579-55590601 TTCCATATTTTTCTGGAGGGGGG - Intergenic
1127314199 15:57779195-57779217 TTTCTTACTGTTCTGGAGGCTGG - Intronic
1127387881 15:58481953-58481975 GTTGCTATTGTTCTGGAGACAGG - Intronic
1127856664 15:62959217-62959239 TTGCATTTTTTTGTAGAGACAGG + Intergenic
1128094187 15:64941364-64941386 TAGCTCATTGTTCTGGAGGCTGG + Intronic
1128163571 15:65441210-65441232 TAGTGTATTATTCTGGAGACAGG - Intergenic
1128303795 15:66584555-66584577 TTTCACATGGTTCTGGAGGCTGG - Intronic
1128643619 15:69359010-69359032 TTGCTAATGGTTCTGGAGGCTGG + Intronic
1128808432 15:70552369-70552391 TTTCTTATGGTTCTGGAGGCTGG + Intergenic
1128990961 15:72260148-72260170 TTTCATATTTTTGTAGAGACGGG - Intronic
1129054690 15:72810700-72810722 TTTCTTATGGTTCTGGAGTCTGG + Intergenic
1129130465 15:73489011-73489033 TTTCTTATAGTTCTGGAGGCTGG + Intronic
1129151396 15:73690478-73690500 TGGCTTGTAGTTCTGGAGACTGG + Intronic
1129439591 15:75570767-75570789 TTGCTTTTTTTTTTGGAGACAGG - Intronic
1129870792 15:78939714-78939736 TTTTATATTTTTGTGGAGACAGG - Intronic
1130133982 15:81166245-81166267 TTGTATTTTTTTGTGGAGACGGG + Intronic
1130666220 15:85872128-85872150 CTGCAGATGGTTCTAGAGACTGG - Intergenic
1130672810 15:85927823-85927845 TTGCTTATCATTCTGGAGGCTGG + Intergenic
1130793376 15:87180614-87180636 TTCTATATTGTTTTGGAGCCAGG + Intergenic
1131321980 15:91402597-91402619 TTTCTCATGGTTCTGGAGACTGG - Intergenic
1131518820 15:93098267-93098289 TTTCTTATAGTTCTGGAGGCTGG + Intergenic
1133003534 16:2864135-2864157 TGGCACATGGTTCTGGAGACTGG - Intergenic
1133152450 16:3845712-3845734 TTGTATTTTTTTGTGGAGACGGG - Intronic
1133517669 16:6525565-6525587 TTTTTCATTGTTCTGGAGACTGG + Intronic
1133538457 16:6724580-6724602 TTTCTTATAGTTCTGGAGGCCGG - Intronic
1133837607 16:9380695-9380717 TTGCTCATGGTTCTGGAGGCTGG + Intergenic
1134643685 16:15849620-15849642 TTGCATTTTTTTGTAGAGACAGG + Intronic
1134851454 16:17482255-17482277 TTGTATTTTTTTCTAGAGACGGG - Intergenic
1135790640 16:25391370-25391392 TGGCCTATAGTTCTGGAGGCTGG + Intergenic
1136095713 16:27954657-27954679 TTTCATTTTGTTTTTGAGACAGG + Intronic
1136236231 16:28915228-28915250 TTGTATTTTTTTGTGGAGACAGG + Intronic
1136468654 16:30463369-30463391 TGGCTTATGGTTCTGGAGGCTGG - Intergenic
1136527599 16:30842301-30842323 TTTCTCATAGTTCTGGAGACTGG - Intronic
1137042041 16:35621903-35621925 TGGCATCTTTTTCTTGAGACAGG - Intergenic
1137268815 16:46889198-46889220 TTGCATTTTTTTGTAGAGACAGG + Intronic
1137288398 16:47035144-47035166 TTGTATATTTTTGTAGAGACGGG - Intergenic
1137382382 16:48011413-48011435 TTTCTTATAGTTCTGGAGGCTGG + Intergenic
1137406711 16:48194818-48194840 TTTCTCACTGTTCTGGAGACTGG - Intronic
1137691266 16:50429703-50429725 TTGCTCATAGTTCTGGAGGCTGG - Intergenic
1138142594 16:54581700-54581722 TTTCTCATGGTTCTGGAGACTGG + Intergenic
1138228185 16:55316980-55317002 TTTCATTTTGGTTTGGAGACTGG - Intergenic
1138307069 16:55988127-55988149 TTTCTTACTGTTCTGGAGTCTGG - Intergenic
1138368624 16:56505048-56505070 TTTCTTATAGTTCTGGAGGCTGG - Intronic
1138422774 16:56910508-56910530 TTGTATTTTTTTATGGAGACAGG + Intronic
1138484089 16:57324943-57324965 TTTCACACAGTTCTGGAGACAGG + Intergenic
1138648921 16:58446119-58446141 TTTCATATTTGTCTAGAGACAGG - Intergenic
1139122312 16:64035342-64035364 TTTCTCATAGTTCTGGAGACTGG + Intergenic
1139286018 16:65815022-65815044 TTCCATAGTTTTTTGGAGACAGG + Intergenic
1139401815 16:66688016-66688038 TTGCTCATAGTTCTGGAGGCTGG + Intronic
1139600145 16:67981606-67981628 TTGCATTTTTTTTTAGAGACAGG + Intergenic
1139681564 16:68568682-68568704 TGGCATATTCTTTTTGAGACAGG + Intronic
1140231106 16:73117933-73117955 TTTCACATGGTTCTGGAGGCTGG - Intergenic
1140535098 16:75702579-75702601 TTTCTCATAGTTCTGGAGACTGG - Intronic
1140864283 16:79046436-79046458 TTTTACATGGTTCTGGAGACTGG + Intronic
1140886581 16:79249560-79249582 TTTCTTATAGTTCTGGAGGCTGG - Intergenic
1141058975 16:80846695-80846717 TTTCTTATAATTCTGGAGACTGG + Intergenic
1141381537 16:83581644-83581666 TTGCATTTTGTTGTAGAGACGGG - Intronic
1141863749 16:86735764-86735786 TTTCTTATAGTTCTGGAGACTGG + Intergenic
1142294095 16:89208971-89208993 TTGTATTTTGTACTAGAGACAGG + Intergenic
1143299780 17:5900806-5900828 TTGCATCTTGGCCTGGGGACAGG + Intronic
1143351318 17:6290288-6290310 TTTCTTGTAGTTCTGGAGACTGG - Intergenic
1143760423 17:9099023-9099045 TTGCATATTGTTTTGTAACCTGG + Intronic
1143907403 17:10220163-10220185 TGGCTTATGGTTCTGGAGGCTGG - Intergenic
1144338169 17:14290788-14290810 TTTCTTATTGTCCTGGAGGCTGG + Intergenic
1144938140 17:18916714-18916736 TTGCTCACAGTTCTGGAGACTGG + Intronic
1145086916 17:19950480-19950502 TTGCATTTTTTGGTGGAGACGGG + Intronic
1146277821 17:31526164-31526186 TTGCATCTGTTTCTGGAGGCTGG + Intronic
1146515607 17:33486830-33486852 CAGCATGTTGTTCTGAAGACAGG + Intronic
1146545550 17:33734848-33734870 TTTCTCATAGTTCTGGAGACTGG - Intronic
1146971701 17:37078208-37078230 TTGCCTTTTGTTGTTGAGACAGG + Intergenic
1146978794 17:37140455-37140477 ATGCATATTGATCTGTAGCCAGG - Intronic
1146981461 17:37165846-37165868 TTGCATTTTTTTGTAGAGACAGG + Intronic
1147289517 17:39430368-39430390 TTGTTTATTTTTCTTGAGACAGG - Intronic
1147606843 17:41778392-41778414 TTGCATTTTTTTGTAGAGACAGG - Intronic
1147733935 17:42622217-42622239 TGGCTTATTTTTGTGGAGACAGG - Intergenic
1148705250 17:49624643-49624665 TTGTATTTTTTTGTGGAGACAGG + Intronic
1149032949 17:52104373-52104395 TTGCATTTATTTGTGGAGACTGG + Intronic
1149062093 17:52434545-52434567 TTGCTTATAGCTCTGGAGGCTGG - Intergenic
1149338988 17:55667100-55667122 TTGTATTTTTTTGTGGAGACAGG - Intergenic
1149619668 17:58033981-58034003 TTGCCTACTGTTCTGGAGGCTGG - Intergenic
1149766990 17:59287516-59287538 TTGCATTTTTTTGTAGAGACAGG + Intergenic
1150151397 17:62811701-62811723 TTGCTTACAGTTCTGGAGGCTGG + Intergenic
1150867681 17:68871101-68871123 TTTCTTATTATTCTGGAGGCTGG + Intronic
1150905258 17:69329506-69329528 TTGTATTTTGTTGTAGAGACAGG + Intergenic
1150928743 17:69561833-69561855 TTGTATTTTGTTTTAGAGACAGG - Intergenic
1151107959 17:71640123-71640145 TTTCTTACTGTTCTGGAGGCTGG - Intergenic
1151347408 17:73510503-73510525 TTTCATTTTGTTTTGGAGACAGG + Intronic
1151824826 17:76518379-76518401 TTTCATATGGTTCTGGAGGCTGG - Intergenic
1151904507 17:77038972-77038994 TTGCATCTTGATTTGGAGCCTGG + Intergenic
1152484387 17:80580626-80580648 TTGTGTTTTGTTTTGGAGACAGG + Intronic
1152507043 17:80756314-80756336 TTTCTTACAGTTCTGGAGACTGG - Intronic
1152830413 17:82493908-82493930 TTGTATATTTTTGTAGAGACGGG + Intergenic
1153295835 18:3545266-3545288 TTTCTTTTTGTTTTGGAGACGGG - Intronic
1153421439 18:4910744-4910766 TTGTATTTTTTTCTAGAGACAGG - Intergenic
1153453514 18:5256094-5256116 TTTCTTACTGTTCTGGAGTCTGG + Intergenic
1153679973 18:7491346-7491368 TTACTCACTGTTCTGGAGACTGG - Intergenic
1154438995 18:14370297-14370319 TTGCTCATAGTTCTGGAGGCTGG - Intergenic
1154990827 18:21596659-21596681 TTTTATATTTTTGTGGAGACGGG - Intronic
1155068198 18:22287065-22287087 TTTCTTATTTTTCTAGAGACGGG + Intergenic
1155096881 18:22564751-22564773 TTGCATTTTGTAGTAGAGACGGG + Intergenic
1155572061 18:27205719-27205741 TTTCTTATAGTTCTGGAGGCTGG + Intergenic
1155798174 18:30066236-30066258 TTGCTTACCATTCTGGAGACGGG + Intergenic
1156588286 18:38457200-38457222 TTTCTTATAGTTCTGGAGGCTGG - Intergenic
1156654027 18:39261997-39262019 TTGCATTTTGTAGTAGAGACAGG - Intergenic
1156770524 18:40716291-40716313 TGGCTCACTGTTCTGGAGACTGG + Intergenic
1156894438 18:42229387-42229409 TTCCATATTGCTTTGGTGACAGG + Intergenic
1156993327 18:43436872-43436894 TTGGATTTTGATCTGGAGAAAGG - Intergenic
1157014054 18:43688237-43688259 TTTCATACTGTTCTGAAAACTGG + Intergenic
1157126783 18:44963715-44963737 TTGTATATTTTTATAGAGACGGG - Intronic
1158274235 18:55749003-55749025 TTGTATATAGTTTTAGAGACGGG + Intergenic
1158326694 18:56320661-56320683 TTTCTCATTGTTCTGGAGGCTGG + Intergenic
1158361604 18:56680183-56680205 TTGCATTTTTTTGTAGAGACAGG - Intronic
1158638037 18:59178446-59178468 TTGTATATTTTTGTGGAGATGGG - Intergenic
1158797395 18:60863621-60863643 TTTCTAATAGTTCTGGAGACTGG - Intergenic
1158827818 18:61243209-61243231 TTTCAGAATGTTCTGGAGAATGG - Intergenic
1158913412 18:62093062-62093084 TTGCATAGTGCTCTGGACACTGG + Intronic
1159096238 18:63905580-63905602 TTTCTCATGGTTCTGGAGACTGG - Intronic
1159335535 18:67060463-67060485 CTGCATAGTGTTTTGGTGACTGG - Intergenic
1159472663 18:68878267-68878289 TTGCATGTTTTTGTAGAGACCGG + Intronic
1159832006 18:73288520-73288542 TTCCTTACTGTTCTGGAGGCTGG + Intergenic
1159902901 18:74064761-74064783 TTGCATGTTGTGCTGGTGGCAGG + Intergenic
1159980730 18:74776283-74776305 TTGCTTACAGTTCTGGAGGCTGG - Intronic
1160004869 18:75062200-75062222 TTGAATCTTGTCCTGAAGACAGG + Intronic
1160185417 18:76672852-76672874 TTGCTCATGGTTCTGGAGGCTGG - Intergenic
1160191032 18:76714063-76714085 TTTCACATAGTTCTGGAGGCTGG - Intergenic
1160279576 18:77475149-77475171 TTGCATTTTTTTGTAGAGACGGG - Intergenic
1160486053 18:79293614-79293636 TTGCTTACAGTTCTGGAGGCTGG - Intronic
1161022805 19:2018775-2018797 TTGTATTTTTTTGTGGAGACAGG - Intronic
1161432245 19:4239464-4239486 TTGCATTTTTTAGTGGAGACAGG - Intergenic
1161441778 19:4295922-4295944 TTGTTTGTTTTTCTGGAGACAGG + Intronic
1161584684 19:5098853-5098875 TTTCTTATGGTTCTGGAGGCTGG - Intronic
1161955423 19:7491657-7491679 TTGCTTTTTGTTTTTGAGACAGG + Intronic
1162328186 19:10010871-10010893 TTACATTTTATTTTGGAGACAGG + Intergenic
1162401099 19:10447071-10447093 TTGCATTTTTTAGTGGAGACGGG + Intronic
1162546325 19:11332515-11332537 TTGCATTTTTTTGTAGAGACAGG + Intronic
1162772782 19:12959771-12959793 TTTCATATTTTACTAGAGACGGG + Intergenic
1163706339 19:18815936-18815958 TTGCTTATAGTTCTTGAGCCCGG - Intergenic
1164168672 19:22703679-22703701 TTGCATTTTTTGGTGGAGACTGG - Intergenic
1164909685 19:31996279-31996301 TTGCATATGTTTTTGGAGAAAGG - Intergenic
1164954788 19:32372950-32372972 TTGCTTACGGTTCTGGAGGCTGG + Intronic
1165556089 19:36633510-36633532 TGGCATATTGTTTTCCAGACCGG - Intergenic
1166035959 19:40168801-40168823 TTGCTTACAGTTCTGGAGACTGG + Intergenic
1166227858 19:41408126-41408148 TTGTATTTTTTTGTGGAGACAGG + Intronic
1166898262 19:46037737-46037759 TTTCTTATGGTTCTGGAGGCTGG + Intergenic
1167825988 19:51973648-51973670 TTGAATATAGATTTGGAGACAGG - Intronic
1167855762 19:52238406-52238428 TTTCTTAGTGTTGTGGAGACTGG - Intergenic
1168068940 19:53938173-53938195 TTGCATTTTTTTGTAGAGACAGG - Intronic
1168569372 19:57452487-57452509 TTTCATACAGTTCTGGAGGCTGG - Intronic
1168572330 19:57481887-57481909 TTCCATATTGTTATGCAGGCTGG + Intergenic
1168646461 19:58062100-58062122 TTGCTCATGGTTCTGGAGGCTGG + Intronic
925243814 2:2360727-2360749 TTTCTCACTGTTCTGGAGACTGG - Intergenic
925258767 2:2511774-2511796 TTTCATACTGTTCTGGAGCCTGG - Intergenic
925281056 2:2685262-2685284 TTGCTTACAGTTCTGGAGGCTGG + Intergenic
925715297 2:6779500-6779522 TTGCTCACAGTTCTGGAGACTGG + Intergenic
925767618 2:7251837-7251859 TGGCATATGGTTCTGAAGGCTGG - Intergenic
925780979 2:7381703-7381725 TTGCTCACAGTTCTGGAGACTGG + Intergenic
925821476 2:7803445-7803467 TTTCTCATGGTTCTGGAGACTGG - Intergenic
926625052 2:15084231-15084253 TTGCATTTTTTTCTAGAGACAGG + Intergenic
926984921 2:18612208-18612230 TTTCTCATTGTTCTGGAGGCTGG + Intergenic
926986229 2:18627201-18627223 TGGCTCATGGTTCTGGAGACTGG - Intergenic
927130916 2:20059744-20059766 TTTCTCATGGTTCTGGAGACTGG + Intergenic
927752086 2:25678221-25678243 TTGTTTGTTGTTCTTGAGACGGG - Intergenic
927752579 2:25682734-25682756 TTGCATTTTCTTGTAGAGACAGG + Intergenic
928139137 2:28712702-28712724 TTGTATATTTTAGTGGAGACGGG - Intergenic
928322116 2:30292177-30292199 TTGCATTTTTTTGTAGAGACAGG - Intronic
928581586 2:32713166-32713188 TTTCTTATAGTTCTGGAGACGGG - Intronic
928640190 2:33289995-33290017 TAGCTCATGGTTCTGGAGACTGG + Intronic
928885363 2:36142281-36142303 TTTCTTATTGTTCTGGAGGCCGG - Intergenic
929269045 2:39952600-39952622 TAGCTTATCGTTCTGGAGGCTGG - Intergenic
929756072 2:44766141-44766163 ATGCATATTGTTCGGAACACCGG + Intronic
929803264 2:45122424-45122446 TTGTATATTTTTGTAGAGACAGG - Intergenic
930165509 2:48199733-48199755 TTTCATATTTTAGTGGAGACGGG - Intergenic
930626094 2:53699050-53699072 TTTCTTACAGTTCTGGAGACTGG + Intronic
931335261 2:61335573-61335595 TTGTATTTTTTTGTGGAGACCGG - Intronic
931674791 2:64683504-64683526 TTTCTTATGGTTCTGGAGGCTGG - Intronic
932269110 2:70393443-70393465 TTGCTCATGGTTCTGGAGGCTGG - Intergenic
932516793 2:72359481-72359503 TTTCCTATAGTTCTGGAGGCTGG - Intronic
933380241 2:81533650-81533672 TTTCGTATTTTTCTAGAGACAGG - Intergenic
933380347 2:81535447-81535469 TTTCGTATTTTTCTAGAGACAGG + Intergenic
934774890 2:96930979-96931001 TTGCTTACAGTTCTGGAGGCTGG - Intronic
935241722 2:101184334-101184356 TTTCATATTTTTATAGAGACGGG - Intronic
935268687 2:101415408-101415430 TTGCTTATAGTTCTGGAGGCTGG - Intronic
935432722 2:102993647-102993669 TTGCTTATGGGTCTGGAGAAGGG - Intergenic
935812334 2:106810776-106810798 TTGTATATTTTTGTAGAGACGGG - Intronic
936090841 2:109500476-109500498 CAGCATATTGGTCTGAAGACAGG + Intronic
936254267 2:110897376-110897398 TTTCTTATAGTTCTGGAGACTGG + Intronic
936445625 2:112592414-112592436 TTCCTTATAGTTCTGGAGAGTGG - Intergenic
936709696 2:115118581-115118603 TTGTTTCTTGTTTTGGAGACGGG + Intronic
937414100 2:121700456-121700478 CTGCCAATTGATCTGGAGACTGG + Intergenic
937734984 2:125277608-125277630 TTGCATTTTTTGGTGGAGACGGG - Intergenic
937947993 2:127358901-127358923 TTTTTTATTGTTTTGGAGACAGG - Intronic
938007121 2:127796243-127796265 TTGTATATTTTTTTAGAGACAGG + Intronic
938017813 2:127882597-127882619 TTCCTTTTTGTTTTGGAGACAGG + Intronic
938179461 2:129166987-129167009 TTTCTCATGGTTCTGGAGACTGG - Intergenic
938294359 2:130168249-130168271 TTGTATTTTTTTGTGGAGACAGG - Intronic
938683823 2:133717716-133717738 TTGCTCATAGTTCTGGAGACTGG + Intergenic
938774941 2:134533294-134533316 GTTCATATTGTTCTGGATCCTGG - Intronic
939046530 2:137256901-137256923 TTTCTTACAGTTCTGGAGACTGG + Intronic
939077166 2:137617724-137617746 TTTCTTATAGTTCTGGAGGCTGG + Intronic
939094331 2:137816607-137816629 TTGCATTTTTTTGTAGAGACAGG + Intergenic
939607313 2:144268583-144268605 TTTCTTACAGTTCTGGAGACTGG - Intronic
939985749 2:148827969-148827991 TTTCTTATAGTTCTGGAGGCTGG - Intergenic
940174400 2:150862884-150862906 TTTCTCACTGTTCTGGAGACTGG + Intergenic
940636248 2:156300577-156300599 TTGCTTACAGTTCTGGAGGCAGG - Intergenic
940667086 2:156621855-156621877 TGGCTCACTGTTCTGGAGACTGG - Intergenic
940698938 2:157017612-157017634 TTTCTCATAGTTCTGGAGACTGG + Intergenic
940823313 2:158382190-158382212 TTGCTTACGGTTCTGGAGGCTGG - Intronic
941015969 2:160356706-160356728 TTGGCTATGGTTCTGGAGGCTGG - Intronic
941024976 2:160448465-160448487 TTGCATTTTTTGATGGAGACGGG + Intronic
941033852 2:160544489-160544511 TTTCTTATAGTTCTGGAGGCTGG - Intergenic
941246961 2:163110350-163110372 TTGTATAGTGTGCTGGGGACAGG + Intergenic
941790802 2:169549636-169549658 TTGTTTTTTGTTGTGGAGACAGG + Intronic
941950530 2:171151188-171151210 TTGTATATTTTTGTAGAGACAGG + Intronic
942493420 2:176512598-176512620 TTTCTCATAGTTCTGGAGACTGG - Intergenic
943025228 2:182619806-182619828 TTGCTCACAGTTCTGGAGACTGG + Intergenic
943051657 2:182920544-182920566 TTGCTTATAGTTCTGGAGGCTGG + Intronic
943114770 2:183654563-183654585 TTGCATTTTTTTGTAGAGACAGG + Intergenic
943275032 2:185855639-185855661 TTGCTCATAGTTCTGGAGACTGG + Intergenic
943726292 2:191255098-191255120 TTACATTTTTTTGTGGAGACGGG + Intronic
944214735 2:197243615-197243637 TTGCTCACAGTTCTGGAGACTGG + Intronic
944348042 2:198692319-198692341 ATCCAAAATGTTCTGGAGACTGG - Intergenic
944463730 2:199979526-199979548 TAGCATAGAGTTCTGGAGCCTGG - Intronic
944717336 2:202388609-202388631 TTGTATTTTGTTGTAGAGACGGG - Intronic
945075829 2:206038657-206038679 TTGCATTTTGTTGTAGAGATGGG - Intronic
945285170 2:208074880-208074902 TTGTATATTCTGCTGGGGACAGG + Intergenic
945529435 2:210932029-210932051 TTGAATTTTGTTTTTGAGACAGG - Intergenic
945997340 2:216449012-216449034 TAGCTCATGGTTCTGGAGACTGG + Intronic
946069915 2:217025234-217025256 TTGCATTTTGATGTGGAGAGGGG - Intergenic
946176635 2:217926211-217926233 TTTCTTATGGTTCTGGAGGCTGG - Intronic
946452677 2:219794496-219794518 TTTCTTATAGTTCTGGAGGCTGG - Intergenic
946900888 2:224370181-224370203 TTTCTTATGGTTCTGGAGGCTGG - Intergenic
947288626 2:228546469-228546491 TTGCTCACAGTTCTGGAGACTGG + Intergenic
947358925 2:229326513-229326535 TTTCTTATGGTTCTGGAGGCTGG - Intergenic
947778257 2:232732799-232732821 TTATATATTTTTGTGGAGACAGG + Intronic
948175714 2:235941064-235941086 TTGCATATTGCTTTAGAAACTGG + Intronic
948281527 2:236750983-236751005 TTTCATATGGTTCTGGAGGCTGG + Intergenic
948361280 2:237422253-237422275 TTTCTTACTGTTCTGGAGGCTGG + Intronic
948378050 2:237535107-237535129 TGGCTCATGGTTCTGGAGACTGG + Intronic
948387205 2:237588341-237588363 TTTCTTATGGTTCTGGAGGCTGG - Intronic
948827774 2:240581663-240581685 TTTCTTATAGTTCTGGAGGCTGG - Intergenic
948875815 2:240827301-240827323 TTGCGTATCATTCTGGAGGCTGG - Intergenic
1169681404 20:8217961-8217983 TTTCTTATAGTTCTGGAGGCTGG - Intronic
1169741904 20:8903844-8903866 TTTCTCATAGTTCTGGAGACTGG - Intronic
1169846217 20:9994831-9994853 TTGCTCATGGTTCTGGAGGCTGG + Intronic
1170100482 20:12693850-12693872 TTTCTTATTGTTCTGGAGACTGG - Intergenic
1170472390 20:16681238-16681260 TTGTTTTTTGTTTTGGAGACAGG - Intergenic
1170696098 20:18660390-18660412 TTGTATTTTTTTGTGGAGACAGG + Intronic
1170810775 20:19672506-19672528 TTTAATTTTTTTCTGGAGACGGG + Intronic
1171437023 20:25131744-25131766 TTGCTCACAGTTCTGGAGACTGG + Intergenic
1171514840 20:25721013-25721035 TTGCATACTGTTGGGTAGACTGG + Intergenic
1172068623 20:32239624-32239646 TTGCATTTTTTTGTAGAGACGGG - Intergenic
1172298920 20:33834314-33834336 TTGTATTTTTTTTTGGAGACAGG + Intronic
1172532143 20:35639505-35639527 TTTCATATTTTTGTAGAGACAGG + Intronic
1172746811 20:37217101-37217123 TTGTATTTTTTTCTAGAGACTGG + Intronic
1172791580 20:37509517-37509539 TTGTATATTGTTCAGGAAAGTGG + Intronic
1172864641 20:38086508-38086530 TTTCATTTTTTTGTGGAGACAGG + Intronic
1172903878 20:38354907-38354929 TTGTATTTTTTTGTGGAGACAGG - Intronic
1173435830 20:43031456-43031478 TTGCTTACAGTTCTGGAGGCTGG - Intronic
1173457327 20:43213981-43214003 TTTCTTATAGTTCTGGAGGCTGG - Intergenic
1173492908 20:43497843-43497865 TGGCTTATGGTTCTGGAGCCTGG - Intergenic
1173571479 20:44079611-44079633 TTTCTCACTGTTCTGGAGACTGG + Intergenic
1173840751 20:46155286-46155308 ATGCATATTGTTCTAGTCACTGG - Intergenic
1174014893 20:47479887-47479909 TTCCAGAATGTTTTGGAGACAGG - Intergenic
1174838239 20:53877740-53877762 TTGTATTTTTTTGTGGAGACAGG - Intergenic
1175124329 20:56740272-56740294 TTGTTTACAGTTCTGGAGACTGG + Intergenic
1175190011 20:57205105-57205127 TTCCTTATAGTCCTGGAGACTGG - Intronic
1176456688 21:6919132-6919154 TTGCTCATAGTTCTGGAGGCTGG + Intergenic
1176834860 21:13784191-13784213 TTGCTCATAGTTCTGGAGGCTGG + Intergenic
1176920593 21:14683481-14683503 TTGCTCATGGTTCTGGAGACTGG - Intergenic
1177036260 21:16046801-16046823 TTACTCACTGTTCTGGAGACTGG + Intergenic
1177197029 21:17914177-17914199 TTTCTCATGGTTCTGGAGACGGG + Intronic
1177337687 21:19754014-19754036 TTGCTTACAGTTCTGGAAACTGG + Intergenic
1177701994 21:24651154-24651176 TTCCTTATAGTTCTTGAGACTGG - Intergenic
1177844692 21:26275266-26275288 TTGTATTTTTTTGTGGAGACAGG + Intergenic
1178076055 21:29014086-29014108 TGGCTTATTGTTCTGGAAGCAGG + Intronic
1178298026 21:31427311-31427333 TTGCATATTTTAGTAGAGACAGG - Intronic
1178462142 21:32811999-32812021 TTTCTTATGGTTCTGGAGACTGG - Intronic
1178598824 21:33978447-33978469 ATGCAGAGAGTTCTGGAGACGGG - Intergenic
1178661624 21:34511555-34511577 TGGCTCATGGTTCTGGAGACTGG - Intergenic
1178700140 21:34826386-34826408 TTTCATATGGTTCTGGAGGCAGG - Intronic
1178711923 21:34924790-34924812 TTTCTTATAGTTCTGGAGGCTGG + Intronic
1178834965 21:36089122-36089144 TTTCTTATAGTTCTGGAGGCTGG - Intergenic
1178988603 21:37332192-37332214 TTGCATTTTTTTGTAGAGACAGG + Intergenic
1179130057 21:38628119-38628141 TTGTATATTTTTGTAGAGACAGG + Intronic
1179131508 21:38641391-38641413 TTTCACATAGTTCTGGAGGCTGG - Intronic
1179158092 21:38868386-38868408 TTTCGTATGGTTCTGGAGGCTGG + Intergenic
1179254543 21:39703830-39703852 TGGCTTATGGTTCTGGAGGCTGG - Intergenic
1179989171 21:44937735-44937757 TGGCTCATGGTTCTGGAGACTGG + Intronic
1180242401 21:46518849-46518871 TTACATATACTTCTTGAGACAGG - Intronic
1182536594 22:31008320-31008342 TTGTATATTGTTGTAGAGATGGG - Intergenic
1182741171 22:32568510-32568532 TTTCTTACTGTTCTGGAGGCTGG + Intronic
1182920145 22:34071881-34071903 TTTCTTATAGTTCTGGAGGCAGG + Intergenic
1183139500 22:35923380-35923402 TTCCATATTGTTTTAGAGATAGG + Intronic
1183173523 22:36205141-36205163 TTTGGTTTTGTTCTGGAGACAGG + Intergenic
1183537320 22:38410522-38410544 TTGCATTTTTTGGTGGAGACGGG - Intergenic
1183967920 22:41454192-41454214 TTTCATATTTTAGTGGAGACAGG - Intergenic
1184153329 22:42650814-42650836 TTGCATTTTTTTGTAGAGACGGG + Intergenic
1184185017 22:42858516-42858538 TTGCATTTTTTTATAGAGACGGG - Intronic
1184204907 22:42995902-42995924 TTTTAAATTTTTCTGGAGACTGG - Intronic
1184509429 22:44924681-44924703 TTTCTTATGGTTCTGGAGGCTGG - Intronic
1184529557 22:45046256-45046278 TTGCATTTTTTTGTGGAGATGGG - Intergenic
1184622566 22:45693356-45693378 TTGCTTACAGTTCTGGAGGCTGG + Intronic
1184641466 22:45874002-45874024 TTGCTCACTGTTCTGGAGGCTGG + Intergenic
1184850905 22:47119828-47119850 TTTCTCACTGTTCTGGAGACTGG + Intronic
949237824 3:1831961-1831983 TTGCTCACAGTTCTGGAGACTGG + Intergenic
949573742 3:5318752-5318774 TTGCTTACAGTTCTGGAGGCTGG - Intergenic
949597144 3:5559996-5560018 TTGCATGCTTTTCTGGAGATGGG - Intergenic
949787088 3:7753618-7753640 TTTCTTACAGTTCTGGAGACTGG - Intergenic
950036079 3:9886792-9886814 TTGCATTTTCTTTTTGAGACAGG + Intergenic
950738117 3:15027601-15027623 TTTCATTTTGTTATTGAGACAGG + Intronic
951044821 3:18026269-18026291 TTGTATATTGTTCTGGGGAATGG - Intronic
951523929 3:23635219-23635241 TTGTATTTTGTTGTAGAGACTGG + Intergenic
951533949 3:23724830-23724852 TTGCTTACAGTTCTGGAGGCTGG + Intergenic
951690499 3:25390414-25390436 TTGCTCATAATTCTGGAGACTGG - Intronic
952170645 3:30803084-30803106 TTTCTTATTATTCTAGAGACAGG - Intronic
952248830 3:31628931-31628953 TTGCATTTTTTTGTAGAGACAGG - Intronic
952275603 3:31872793-31872815 TTTCATATTTTTTTGGAGACAGG + Intronic
953000645 3:38929911-38929933 TTTCTTACAGTTCTGGAGACTGG - Intronic
953008047 3:38996134-38996156 TTTCTTATAGTTCTGGAGGCTGG - Intergenic
953299525 3:41758208-41758230 TTGCTCACTGTTCTGGAGGCTGG - Intronic
953960913 3:47265015-47265037 TTTCACATAGTTCTGGAGACTGG - Intronic
954221275 3:49155870-49155892 TTGTATTTTTTTGTGGAGACAGG - Intergenic
954315346 3:49798411-49798433 TTGTATTTTGTAGTGGAGACAGG - Intronic
955307666 3:57850422-57850444 TTTCAAATTTTTTTGGAGACAGG + Intronic
955359991 3:58265702-58265724 TGGCTTATTGTTCTGGAGGTTGG + Intronic
955775790 3:62431588-62431610 GTGCCAATTGTTCTGCAGACTGG - Intronic
955998054 3:64698297-64698319 TGGCTTATAGTTCTGGAGACTGG + Intergenic
956009060 3:64811131-64811153 TTGCATTTTTTTGTAGAGACAGG + Intergenic
956237535 3:67090877-67090899 TTTCTTACTGTTCTGGAGGCTGG - Intergenic
956456830 3:69429930-69429952 TTGTATTTTTTTGTGGAGACAGG + Intronic
956495032 3:69815832-69815854 TTGAATTTTGTTCTGGAAAGTGG + Intronic
956723901 3:72141377-72141399 TAGCTCATGGTTCTGGAGACTGG + Intergenic
956767722 3:72498086-72498108 TTTCTTATAGTTCTGGAGGCTGG + Intergenic
957038398 3:75316250-75316272 TTGCTCATAGTTCTGGAGGCTGG + Intergenic
957167289 3:76691315-76691337 TGGCTTATGGTTCTGGAGGCTGG - Intronic
957170741 3:76733834-76733856 TTTCTTATAGTTCTGGAGGCTGG + Intronic
957632194 3:82731208-82731230 TTGAAAATTGTTCTGAACACTGG + Intergenic
957635119 3:82773467-82773489 TAGCATATAGTTCTAGAGTCTGG - Intergenic
957638828 3:82822326-82822348 TTTTATATTGTTTTAGAGACAGG + Intergenic
957656788 3:83089687-83089709 TGGCTTATGGTTCTGCAGACTGG + Intergenic
958077406 3:88699466-88699488 TTTCTTATAGTTCTGGAGGCTGG - Intergenic
958094839 3:88930707-88930729 GTGAATGTTTTTCTGGAGACAGG + Intergenic
958787609 3:98614851-98614873 TTGCATCTTCTTCTGGGGAAAGG + Intergenic
959090368 3:101896095-101896117 GTGTATATTGCTCTGGAGATGGG - Intergenic
959517977 3:107290974-107290996 TTTCTCACTGTTCTGGAGACTGG - Intergenic
959805207 3:110543072-110543094 TTTCTTACAGTTCTGGAGACTGG - Intergenic
959942956 3:112098673-112098695 TTGCTTACAGTTCTGGAGGCTGG + Intronic
959949961 3:112168837-112168859 TGGCATATTGATCTGAAGACAGG + Intronic
960356367 3:116658346-116658368 TTTCCTATAGTTCTGGAGGCTGG - Intronic
960610584 3:119551595-119551617 TTTCTTACTGTTCTGGAGGCTGG - Intronic
961364080 3:126388473-126388495 TTGCATTTTTTTGTAGAGACAGG - Intergenic
961524836 3:127490178-127490200 TTTCTCATAGTTCTGGAGACTGG - Intergenic
961648693 3:128406637-128406659 TTGCATTTTTTTGTGGAGATGGG - Intronic
961757924 3:129141353-129141375 TTGCATTTTTTTGTAGAGACAGG - Intronic
961800244 3:129442310-129442332 TTCCAAATTATTCTAGAGACAGG + Intronic
961830490 3:129620683-129620705 CTGCTTTTTGTTTTGGAGACAGG - Intergenic
962000131 3:131287182-131287204 TTACCTCTTGTTCTGGAGGCAGG - Intronic
962160868 3:132998920-132998942 TGGCTTACAGTTCTGGAGACTGG - Intergenic
962354888 3:134685439-134685461 TTGCCTTTTGTTCTAGAGTCTGG + Intronic
962362237 3:134752251-134752273 ATGCAGAGTGTTCTGGAGATGGG - Intronic
963107813 3:141661234-141661256 TTTCTTACAGTTCTGGAGACTGG + Intergenic
963374608 3:144448288-144448310 TTGCTTATAGCTCTGGAGGCTGG + Intergenic
963507656 3:146207420-146207442 TTTCTTATAGTTCTGGAGGCTGG + Intronic
963728106 3:148944515-148944537 TTGCATTTTTTTGTAGAGACGGG - Intergenic
963987249 3:151610704-151610726 TGGCATATGGTTCTGGAGGCTGG + Intergenic
964222885 3:154367022-154367044 TTGCTCACTGTTCTGGAGGCTGG + Intronic
964798276 3:160523674-160523696 TTGCATTTTTTAGTGGAGACAGG - Intronic
964830436 3:160878354-160878376 TTTCTCATGGTTCTGGAGACTGG + Intronic
965007071 3:163041005-163041027 CTGCATTTTGTTCTGGTAACAGG + Intergenic
965329662 3:167355632-167355654 TTGCATATGGTTATGCTGACTGG - Intronic
965525151 3:169708466-169708488 TTGCTTACAGTTCTGGAGGCTGG - Intergenic
965676299 3:171200568-171200590 TTAAATATTGTCCTGGAGAGGGG - Intronic
965768693 3:172158107-172158129 TTGCTCATGGTTCTGGAGACTGG - Intronic
966063701 3:175790529-175790551 TTGAGTATTGTTCTGGGGATTGG + Intronic
966758861 3:183397230-183397252 TTTCTCATGGTTCTGGAGACTGG + Intronic
966777170 3:183553072-183553094 ATGAATACTGTCCTGGAGACAGG - Intronic
966809296 3:183829147-183829169 TTTCAGATTGTGCTGGAGAGGGG + Intergenic
967172300 3:186831192-186831214 TTGCTTACAGTTCTGGAGGCTGG - Intergenic
967186908 3:186951821-186951843 TTGCTCATAGTTCTGGAGGCTGG + Intronic
967436275 3:189450427-189450449 TTTAATATTGTTTTAGAGACAGG + Intergenic
967701265 3:192594798-192594820 TTTCTTACAGTTCTGGAGACTGG - Intronic
967746886 3:193066228-193066250 TTGCATATATTTTTTGAGACAGG - Intergenic
967774755 3:193375002-193375024 TTTATTATTGTTCTGGAGGCTGG - Intronic
968557398 4:1253329-1253351 TGGCTTATGGTTCTGGAGGCTGG + Intergenic
968856283 4:3126223-3126245 TTGTATTTTTTTGTGGAGACGGG + Intronic
969127307 4:4960660-4960682 TTGCATTTTTTTGTAGAGACAGG + Intergenic
970176731 4:13346839-13346861 TATCTTACTGTTCTGGAGACAGG - Intergenic
970197079 4:13561805-13561827 TTACTTATCGTTCTGGAGGCTGG + Intergenic
970857780 4:20668511-20668533 TATCTTACTGTTCTGGAGACAGG + Intergenic
970970443 4:21977155-21977177 TTGCTCATAGTTCTGGAGAGTGG + Intergenic
971212807 4:24636135-24636157 TTTCCTACTGTTCTGGAGGCTGG - Intergenic
971288670 4:25314487-25314509 TTTCTTACAGTTCTGGAGACTGG + Intronic
971666575 4:29494005-29494027 TTGGTTATTGTTCTGCAGCCTGG - Intergenic
972775832 4:42239631-42239653 TTGCTCATAGTTCTGGAGGCTGG - Intergenic
972936483 4:44142288-44142310 TTTCTCATAGTTCTGGAGACTGG - Intergenic
973263237 4:48186028-48186050 TTGCATTTTTTGGTGGAGACAGG + Intronic
973297306 4:48538951-48538973 TTCCTTATTGTTCTTGAGAGGGG + Intronic
973320832 4:48808703-48808725 TATCATATAGTTCTGGAGGCTGG - Intronic
973534156 4:51864529-51864551 TTGTTCATGGTTCTGGAGACTGG + Intronic
973563362 4:52159386-52159408 TTGCATTTTTTTATAGAGACAGG + Intergenic
973665581 4:53155448-53155470 TGGCTTATGGTTCTGGAGGCTGG - Intronic
973686134 4:53371673-53371695 TTTCTCACTGTTCTGGAGACTGG + Intergenic
973901590 4:55480268-55480290 TTTCCTTTTTTTCTGGAGACAGG + Intronic
973965752 4:56160353-56160375 TTGTATATTTTTGTAGAGACAGG + Intergenic
973969252 4:56194736-56194758 TTTCTCATTGTTCTGGAGGCTGG - Intronic
974170994 4:58267113-58267135 TTTCTTATAATTCTGGAGACTGG - Intergenic
974345610 4:60677197-60677219 TTGCATTTTGTGGTAGAGACGGG + Intergenic
974790554 4:66682913-66682935 TTGCTTATAGTTCTGGAGGCTGG - Intergenic
974804644 4:66862086-66862108 TTTCTCATAGTTCTGGAGACTGG + Intergenic
974846201 4:67353440-67353462 TGGCTTATGATTCTGGAGACTGG + Intergenic
975066438 4:70070737-70070759 TTACATATTATTATGGAGAAAGG + Intergenic
975120269 4:70720490-70720512 TTTCATATTGTTACGAAGACAGG - Intronic
975298364 4:72760458-72760480 TTTCTTATAGTTCTGGAGGCTGG - Intergenic
975867081 4:78735066-78735088 TTTCTTACAGTTCTGGAGACTGG + Intergenic
975871720 4:78786359-78786381 TTTCTTACTGTTATGGAGACTGG - Intronic
975936624 4:79589171-79589193 TTGCATAGTGTTGAGGAGGCTGG - Intergenic
976104701 4:81604233-81604255 TGGCTTATGGTTCTGGAGGCTGG - Intronic
976396479 4:84561074-84561096 TGGCTTATAGTTCTGGTGACTGG - Intergenic
976406808 4:84668664-84668686 TTACTTATAGTTCTGGTGACGGG - Intergenic
977003321 4:91531643-91531665 TTGCTCACAGTTCTGGAGACTGG + Intronic
977228353 4:94421543-94421565 TTTCTCATAGTTCTGGAGACTGG - Intergenic
977336046 4:95700983-95701005 TTTCTTATAGTTCTGGAGACTGG - Intergenic
977423725 4:96837988-96838010 TTTCTTATGGTTCTGGAGTCTGG - Intergenic
977465269 4:97376622-97376644 TTTCTTATAGTTCTGGAGGCTGG + Intronic
977983727 4:103357956-103357978 TTGCTTACAGTTCTGGAGACTGG + Intergenic
977988899 4:103417899-103417921 TTTCTTATAATTCTGGAGACTGG + Intergenic
978085865 4:104653322-104653344 TGGCATACAGTTCTAGAGACTGG + Intergenic
978168822 4:105644037-105644059 TTGTATTTTTTTCTAGAGACGGG + Intronic
978877834 4:113663655-113663677 TTGAATTTTGTTATGGAGACAGG + Intronic
978887559 4:113783308-113783330 TTTCTTATTTTTCTGGAGATGGG - Intergenic
978913873 4:114099621-114099643 TTGCTCATCGTTCTGGAGGCTGG + Intergenic
979100966 4:116613587-116613609 TTGTATTTTTTTGTGGAGACAGG + Intergenic
979113501 4:116789721-116789743 TTTCTTATAGTTCTGGAGATTGG - Intergenic
979120616 4:116895412-116895434 TTTCATATTTTTGTGGAGATAGG - Intergenic
979173789 4:117636368-117636390 TTTCTTAGTGTTCTGGAGGCTGG - Intergenic
980114513 4:128666393-128666415 TTTCACACTGTTCTGGAGGCTGG + Intergenic
980161853 4:129173822-129173844 TAGCATATTGTTCTCGTGCCTGG + Intergenic
980254660 4:130363093-130363115 TTTAATTTTTTTCTGGAGACGGG + Intergenic
980508382 4:133754022-133754044 TTTCTTATGGTTCTGGAGGCTGG + Intergenic
980571045 4:134620786-134620808 TGGCTCATTGTTCTGGAGGCTGG + Intergenic
980879209 4:138692365-138692387 TTGCTCATAGTTCTGGAGGCTGG - Intergenic
981280339 4:142950698-142950720 TTGCTTCTTTTTCTGGATACTGG - Intergenic
981438285 4:144751933-144751955 TTGTATTTTTTTGTGGAGACAGG - Intergenic
981497675 4:145412018-145412040 TTCCTCATTGTTCTGGAGGCTGG - Intergenic
981881664 4:149620287-149620309 TTTCTTACTGTTCTGGAGGCTGG - Intergenic
982079753 4:151778002-151778024 TTGCTTACAGTTCTGGAGGCTGG + Intergenic
982236026 4:153251805-153251827 TTGTATTTTTTTATGGAGACAGG - Intronic
982293566 4:153804256-153804278 TTCCTTATTGTTCTGGAGGCTGG + Intergenic
982624276 4:157745822-157745844 TAGCTCATTGTTCTGGAGGCTGG - Intergenic
983022266 4:162692360-162692382 TGGCTCATGGTTCTGGAGACTGG - Intergenic
983163832 4:164450844-164450866 TTTCTTATTGTTCTGGAAGCTGG - Intergenic
983628641 4:169827974-169827996 TTGCATTTTTTGGTGGAGACGGG + Intergenic
983675419 4:170286805-170286827 TTACATATTTTTGTAGAGACAGG + Intergenic
983885053 4:172971219-172971241 TGGCTCATGGTTCTGGAGACTGG - Intronic
983927200 4:173414949-173414971 TTCCCTCTTATTCTGGAGACAGG - Intergenic
983928038 4:173423803-173423825 TGGCTTATGGTTCTGGAGTCAGG + Intergenic
983960890 4:173752670-173752692 TTGCAAAATGGGCTGGAGACTGG + Intergenic
984399504 4:179243804-179243826 TTGCTTATAATTCTGGAGATTGG + Intergenic
984432019 4:179661929-179661951 TTGCTCATCTTTCTGGAGACTGG - Intergenic
984730371 4:183062780-183062802 TGGCTTATGGTTCTGGAGGCTGG - Intergenic
984733176 4:183087332-183087354 TTGTATATTTTTTTAGAGACAGG + Intergenic
984812946 4:183810808-183810830 TGGCTTATGGTTCTGGAGGCTGG - Intergenic
984942003 4:184941094-184941116 TTGCCTCTTGTTTTTGAGACAGG + Intergenic
985005038 4:185525887-185525909 TTTCTCACTGTTCTGGAGACCGG - Intronic
985056728 4:186042294-186042316 TTGCATTTTTTTGTAGAGACAGG + Intergenic
985198911 4:187463329-187463351 TTGCTCACAGTTCTGGAGACTGG - Intergenic
985515228 5:340363-340385 TTTCACACTGTTCTGGAGGCTGG + Intronic
985984421 5:3502887-3502909 TTGCCCATTCTTCTTGAGACAGG + Intergenic
986148029 5:5098690-5098712 TTCCTCATGGTTCTGGAGACTGG + Intergenic
986291519 5:6403455-6403477 TTTCTTATAGTTCTGGAGGCTGG + Intergenic
986795592 5:11208436-11208458 TTTCATATTGTTCTGTATATTGG - Intronic
986830329 5:11569919-11569941 TTTCTTACAGTTCTGGAGACTGG - Intronic
987203013 5:15596489-15596511 TTACTTATTTTTGTGGAGACAGG - Intronic
987294900 5:16541254-16541276 TTGCTCACTGTTCTGGAGGCTGG - Intronic
987324273 5:16798160-16798182 TGGCTTATGGTTCTGGAGACTGG - Intronic
987417131 5:17674151-17674173 TTTCTTACTGTTCTGGAGGCTGG + Intergenic
987472130 5:18345250-18345272 TTTTTTATTGTTCTGGAGGCTGG + Intergenic
987482678 5:18478239-18478261 TAGCTCAGTGTTCTGGAGACTGG + Intergenic
987877266 5:23693840-23693862 TTTCTTACAGTTCTGGAGACTGG + Intergenic
988019771 5:25608051-25608073 TTGAACATTTTTCTGGATACTGG - Intergenic
988173583 5:27691296-27691318 TTTCATATGGTTCTAGAGGCTGG - Intergenic
988833242 5:35007269-35007291 TTCCTCATGGTTCTGGAGACTGG - Intronic
989016379 5:36939655-36939677 TTTCTTATAGTTCTGGAGTCTGG + Intronic
989037850 5:37194093-37194115 TTGCATATTTTAGTAGAGACAGG + Intronic
989994938 5:50818399-50818421 TTGTATTTTTTTGTGGAGACAGG + Intronic
990424688 5:55674601-55674623 TTTCTTATAGTTGTGGAGACTGG - Intronic
990500870 5:56396167-56396189 TTTCTCATAGTTCTGGAGACCGG + Intergenic
990501223 5:56398480-56398502 TTGTATATTTTGGTGGAGACGGG - Intergenic
990595747 5:57310764-57310786 TTCCTTATAGTTCTGGAGGCTGG - Intergenic
990655841 5:57954206-57954228 TTTCTTAAAGTTCTGGAGACTGG - Intergenic
990661307 5:58018483-58018505 TTTCACATAGTTCTGGAGCCTGG - Intergenic
990958177 5:61364622-61364644 TTTCCTATAGTTCTGGAGGCTGG + Intronic
991327599 5:65454204-65454226 TAGCATATGGTTCTGGATGCTGG - Intronic
991698181 5:69293140-69293162 TTTCTTTTTGTTTTGGAGACAGG + Intronic
992000479 5:72431311-72431333 TGGCTCATGGTTCTGGAGACTGG - Intergenic
992070550 5:73144708-73144730 TTTCTCATAGTTCTGGAGACTGG - Intergenic
992148998 5:73882468-73882490 TTGCATTTTCTTCTGAAAACTGG - Exonic
992152330 5:73917524-73917546 TTGCATATTTCTCTGGGGGCAGG + Intronic
992214193 5:74509104-74509126 TTTCTTACTGTTCTGGAGGCTGG - Intergenic
992229330 5:74648459-74648481 CTGCAGATTGTGCTGGAGAAGGG - Intronic
992255559 5:74917545-74917567 TTTCTCATAGTTCTGGAGACTGG + Intergenic
992407053 5:76469573-76469595 TTTTATATTGTTGTAGAGACAGG + Intronic
992415942 5:76551679-76551701 TTGCATTTTTTGGTGGAGACGGG - Intronic
993552339 5:89288982-89289004 TTGCTTACAGTTCTGGAGGCTGG - Intergenic
994228754 5:97287488-97287510 TTTCTTATAGTTCTGGAGGCTGG + Intergenic
994363026 5:98877165-98877187 TTGCTTTTTGTTTTTGAGACAGG - Intronic
994427671 5:99614245-99614267 TTTCTTACTGTTCTGGAGATTGG + Intergenic
994529642 5:100953101-100953123 TTTCTTATAGTACTGGAGACTGG + Intergenic
994874211 5:105394019-105394041 CTGCACATTGATCTGGAGAAAGG + Intergenic
995485065 5:112632046-112632068 TGGCTCATGGTTCTGGAGACTGG + Intergenic
995556567 5:113335973-113335995 TGGCTTATAGTTCTGGAGGCTGG + Intronic
996142163 5:119925011-119925033 TTGGATTTTGTTTTAGAGACAGG - Intergenic
996382142 5:122873144-122873166 TTGTATTTTTTTCTAGAGACGGG + Intronic
996792184 5:127304910-127304932 TTTCTTATGGTTCTGGAGGCAGG - Intronic
996849224 5:127933928-127933950 TTTCTCATAGTTCTGGAGACTGG - Intergenic
996919970 5:128756664-128756686 TTGCTCATGGTTCTGGAGTCTGG + Intronic
997247988 5:132367416-132367438 TTGCATTTTTTTTTTGAGACAGG - Intergenic
997487255 5:134241884-134241906 TTTTATTTTTTTCTGGAGACAGG + Intergenic
997502495 5:134387552-134387574 TGGCTCATGGTTCTGGAGACTGG + Intronic
997534317 5:134605631-134605653 TTTCATTTTGTTTTAGAGACGGG - Exonic
997910190 5:137863959-137863981 TTGCATATTTTTGTAGAGATGGG - Intergenic
998322485 5:141245801-141245823 TTGCAGCTTGATCTGCAGACCGG + Exonic
998806365 5:145920989-145921011 TTGCTCATAGTTCTGGAGGCTGG - Intergenic
998990297 5:147808109-147808131 TTGCATATTGTGCTGGTGTAAGG - Intergenic
999089533 5:148923633-148923655 TTTCTTACAGTTCTGGAGACTGG + Intronic
999136568 5:149324241-149324263 TTTCTCATTGTTCTGGAGGCTGG + Intronic
999858302 5:155619195-155619217 TTGCATATTGTCATGGCCACAGG - Intergenic
999912628 5:156221180-156221202 TGGGTTATAGTTCTGGAGACTGG + Intronic
999989761 5:157038947-157038969 TTTTATTTTTTTCTGGAGACAGG - Intronic
1000091122 5:157930460-157930482 TTGCATTTTTTTGTAGAGACGGG - Intergenic
1000103571 5:158037820-158037842 TTGCATTTTTTGGTGGAGACGGG - Intergenic
1000131325 5:158303008-158303030 TTTCTTATAGTTCTGGAGGCTGG + Intergenic
1000261266 5:159590935-159590957 TTGCTTACAGTTCTGGAGGCTGG + Intergenic
1000541296 5:162543262-162543284 TTGCATATGCATCTGGAGATGGG + Intergenic
1000630382 5:163584410-163584432 TTGCATTTTTTGGTGGAGACGGG - Intergenic
1000978739 5:167793661-167793683 TTGCATTTTTTGGTGGAGACGGG - Intronic
1001520928 5:172392358-172392380 TTTCCTACAGTTCTGGAGACTGG - Intronic
1001659125 5:173377438-173377460 TTTCAGATAGTTCTGGAGGCTGG - Intergenic
1002369985 5:178744044-178744066 TTTCATATTGTTATAGAGAAGGG - Intergenic
1002462831 5:179384437-179384459 TTGCTCATAGTTCTGGAGGCTGG + Intergenic
1002610010 5:180411169-180411191 TTGCTGACAGTTCTGGAGACTGG + Intergenic
1002626299 5:180531809-180531831 TTGCATTTTTTGGTGGAGACGGG - Intronic
1002887009 6:1306368-1306390 TTTCTTATAGTTCTGGAGACTGG - Intergenic
1003652825 6:7977098-7977120 TTGCTTACAGTTCTGGAGGCTGG + Intronic
1004149393 6:13101132-13101154 TGGCTTATGGTTCTGGAGGCTGG + Intronic
1004659488 6:17697512-17697534 TTGCATTTTTTAATGGAGACAGG - Intronic
1004769125 6:18762022-18762044 TTTCTTATAGTTCTGGAGGCTGG - Intergenic
1005006460 6:21292202-21292224 TTTCTTACAGTTCTGGAGACTGG + Intergenic
1005359166 6:25014502-25014524 TTGCACATGATTCTGGAAACAGG + Intronic
1005384597 6:25273277-25273299 TTGCATTTTTTTGTAGAGACGGG + Intergenic
1005446799 6:25932200-25932222 TTGCATTTTTTTGTGGAGACGGG - Intergenic
1005457396 6:26034089-26034111 TTGGTTATTTTACTGGAGACAGG - Intergenic
1005518267 6:26575035-26575057 TTGCTCACAGTTCTGGAGACTGG - Intergenic
1005522528 6:26613436-26613458 GTGCACAGTGTTCTGGTGACAGG + Intergenic
1005622120 6:27629851-27629873 TTTTTTATAGTTCTGGAGACAGG + Intergenic
1005666190 6:28058906-28058928 TTGCATTTTTTTGTAGAGACAGG + Intergenic
1005770426 6:29065111-29065133 TTGCTTACAGTTCTGGAGGCTGG + Exonic
1006619693 6:35354878-35354900 GTGGATTTTGTGCTGGAGACCGG + Intronic
1006869250 6:37235673-37235695 TTTCTTATGGTTCTGGAGGCTGG + Intronic
1007492128 6:42231290-42231312 TTTCTTATAGTTCTGGAGGCTGG - Intronic
1007548484 6:42711266-42711288 TTTCTTACTGTTCTGGAGGCTGG - Intronic
1007867834 6:44992990-44993012 TTTCATATTTTTGTAGAGACAGG - Intronic
1007874356 6:45079134-45079156 TTGTATTTTGTTGTAGAGACGGG - Intronic
1008283034 6:49618873-49618895 TTTCTTATGGTTCTGGAGGCTGG + Intronic
1008330840 6:50241843-50241865 TGGCTTATGGTTCTGGAGGCTGG - Intergenic
1008458968 6:51745526-51745548 TTTCTTATAGTTCTGGAGGCTGG - Intronic
1008955833 6:57214473-57214495 TTGCATTTTTTTGTAGAGACAGG + Intronic
1009400661 6:63251522-63251544 TGGCTTATTGTTCTGGAGGCCGG - Intergenic
1009947427 6:70356006-70356028 TTTCTTATAGTTCTGGAGGCTGG - Intergenic
1009967721 6:70594593-70594615 TTTCTTATGGTTCTGGAGGCTGG - Intergenic
1010248625 6:73685073-73685095 TTGCATTTTTTAGTGGAGACGGG + Intergenic
1010368864 6:75084537-75084559 TTGCAGATTATTCTGCAGAGAGG - Exonic
1010447690 6:75966557-75966579 TTGCTTATAGTTCTGGAGGCTGG - Intronic
1010747985 6:79586022-79586044 TTGTATATTTTAGTGGAGACAGG - Intergenic
1011289923 6:85766281-85766303 TTGCTTATGGTTCTGGAGGCTGG + Intergenic
1011369913 6:86625433-86625455 TTGCTTATGGTTCTGGAGGCTGG + Intergenic
1011409808 6:87056280-87056302 TGGCTTATGGTTCTGGAGTCTGG + Intergenic
1011611453 6:89155459-89155481 TTGTATGTTTTTCTGGAGACAGG + Intronic
1011780710 6:90786346-90786368 TGGCTTATAGTTCTGGAAACTGG + Intergenic
1011877970 6:91985481-91985503 TTGCTTAGAGTTCTGGAGGCTGG - Intergenic
1011889607 6:92140802-92140824 TGGCTTATAGTTCTGGAGGCTGG - Intergenic
1012616091 6:101281837-101281859 TTTCCTATAGTTTTGGAGACTGG - Intergenic
1012986006 6:105877145-105877167 TTTCTTACAGTTCTGGAGACTGG + Intergenic
1013093436 6:106921939-106921961 TTGCATAGTGTTCTGGAAAGTGG + Intergenic
1013576765 6:111491262-111491284 TTTCATATTTTTTTGGAGACAGG + Intergenic
1013759378 6:113499093-113499115 TTGCTTACAGTTCTGGAGGCTGG + Intergenic
1014159877 6:118155567-118155589 TTTCTTATGGTTCTGGAGGCTGG - Intronic
1014707193 6:124762132-124762154 TTTCTCATAGTTCTGGAGACTGG + Intronic
1014809757 6:125871822-125871844 TTGCATTTTTTTGTAGAGACAGG - Intronic
1014857681 6:126422354-126422376 TTTCTCATAGTTCTGGAGACCGG + Intergenic
1014875989 6:126660487-126660509 TTGCATGTTGTTTTGGAAAGTGG - Intergenic
1015094619 6:129400037-129400059 TTTCTTATGGTTCTGGAGGCTGG + Intronic
1015358097 6:132304321-132304343 TTGCTTATTGTTGTGAAGATGGG - Intronic
1015977659 6:138807143-138807165 TTGTATTTTTTTGTGGAGACAGG + Intronic
1016299309 6:142612293-142612315 TTTCTTACAGTTCTGGAGACTGG + Intergenic
1016540401 6:145157974-145157996 TTTCTTATTTTTCTGGAGGCTGG - Intergenic
1016701542 6:147059734-147059756 GCTCATATTGTTATGGAGACAGG - Intergenic
1016904622 6:149136665-149136687 TTGCTTACAGTTCTGGAGGCTGG + Intergenic
1017155028 6:151315240-151315262 TTACTTATAGTTCTGGAGGCTGG + Intronic
1017324900 6:153132544-153132566 TTTCTTACAGTTCTGGAGACTGG + Intergenic
1017339020 6:153298614-153298636 TTTCTTATAGTTCTGGAGGCTGG - Intergenic
1017516565 6:155161349-155161371 TTGCATTTTTTTGTAGAGACAGG + Intronic
1017581665 6:155871785-155871807 TTGCTCACAGTTCTGGAGACTGG + Intergenic
1017735942 6:157363626-157363648 TTTCTTATAGTTCTGGAGGCTGG + Intergenic
1017753235 6:157508370-157508392 TTGTATTTTTTTCTTGAGACAGG + Intronic
1017852332 6:158315693-158315715 TTGCTTACAGTTCTGAAGACTGG + Intronic
1018003992 6:159603366-159603388 TTTCTTACAGTTCTGGAGACTGG + Intergenic
1018175043 6:161171325-161171347 TTTCTTATAGTTCTGGAGGCTGG + Intronic
1018332168 6:162741362-162741384 TTTCTCATGGTTCTGGAGACTGG + Intronic
1018484086 6:164222644-164222666 TTTCCTATAGTTCTGGAGGCTGG - Intergenic
1018504103 6:164444865-164444887 TTGCTTAGAGTTCTGGAGGCTGG - Intergenic
1018685595 6:166301883-166301905 TTTCTTATAGTTCTGGAGGCTGG - Intergenic
1018779414 6:167048355-167048377 TTGCATTTTTTTGTAGAGACAGG - Exonic
1019157326 6:170048050-170048072 TTTCCTAGTGTTCTGGAGATGGG - Intergenic
1019862822 7:3676136-3676158 TTGTATTTTTTTGTGGAGACGGG + Intronic
1019862829 7:3676188-3676210 TTGTATTTTTTTGTGGAGACGGG + Intronic
1019941378 7:4294427-4294449 TGGCTTATGGTTCTGGAGGCTGG - Intergenic
1020835114 7:13139580-13139602 TTGCTCATGGTTCTGGAGGCAGG + Intergenic
1020989417 7:15178826-15178848 TGGCTTATGGTTCTGGAGGCTGG + Intergenic
1021078114 7:16330281-16330303 TTAAATATTCTTCTGGAGAATGG - Intronic
1022133626 7:27426477-27426499 TTTCCTATAGTTCTGGAGGCTGG + Intergenic
1022141202 7:27494435-27494457 TTTCTCATGGTTCTGGAGACTGG + Intergenic
1022178931 7:27899440-27899462 GTGGATATTTTTTTGGAGACAGG + Intronic
1022220284 7:28307493-28307515 TTTCTTATAGTTCTGGAGGCTGG - Intronic
1022416815 7:30185626-30185648 TTGCTCATAGTTCTGGAGACTGG + Intergenic
1022876112 7:34532109-34532131 TTTCTCATTTTTCTGGAGACAGG - Intergenic
1023715308 7:43037818-43037840 TTTCTTATAGTTCTGGAGGCTGG - Intergenic
1023884084 7:44339502-44339524 TTTCATCTTTTTCTTGAGACAGG + Intergenic
1023887613 7:44371774-44371796 TTGTATTTTTTACTGGAGACTGG - Intergenic
1024039020 7:45535181-45535203 TTTCTTATAGTTCTGGAGTCTGG - Intergenic
1024237968 7:47412445-47412467 TTTCATATTTTTGTAGAGACGGG - Intronic
1024425989 7:49227060-49227082 TTGCTGACAGTTCTGGAGACAGG - Intergenic
1024574825 7:50755062-50755084 TTTCTTATAGTTCTGGAGGCTGG - Intronic
1024754080 7:52507618-52507640 TTGTATGTTTTACTGGAGACAGG - Intergenic
1025024991 7:55509310-55509332 TTGCTCATAGTTCTGGAGGCTGG + Intronic
1025074834 7:55933875-55933897 TTGCATCTTTTTGTAGAGACAGG + Intronic
1026001390 7:66561435-66561457 TTGTATTTTGTTGTAGAGACGGG - Intergenic
1026092495 7:67312826-67312848 TTGTATTTTGTTTTGAAGACAGG + Intergenic
1026122430 7:67549706-67549728 TTGCTCATGGTTCTGGAGGCTGG + Intergenic
1026244450 7:68606321-68606343 TTGCTCACTGTTCTGGAGGCTGG - Intergenic
1026272825 7:68851428-68851450 TTGCATAATGTTATGAAGAGAGG - Intergenic
1026407301 7:70079839-70079861 TGGCAGATGGTTCTGGAGACTGG + Intronic
1026491355 7:70866562-70866584 TTGCTCATGGTTCTGGAGGCTGG + Intergenic
1026575548 7:71568364-71568386 TTGCATCTTGTGCTTGAGACAGG + Intronic
1026650357 7:72210877-72210899 TTTAATTTTTTTCTGGAGACCGG - Intronic
1026835108 7:73633491-73633513 TTGAATTTTTTTGTGGAGACAGG + Intergenic
1027048205 7:75005036-75005058 TTGCATTTTTTTGTAGAGACAGG + Intronic
1027180122 7:75933207-75933229 TGGCATATTGTTTTGAAGTCTGG + Intronic
1027480262 7:78686968-78686990 TTTTATATTATACTGGAGACTGG + Intronic
1027570004 7:79853870-79853892 TTTCTTATAGTTCTGGAGAGTGG - Intergenic
1027683734 7:81254808-81254830 TGGCTCATGGTTCTGGAGACTGG + Intergenic
1028197598 7:87925308-87925330 TTTCTTATAGTTCTGGAGGCTGG - Intergenic
1028247801 7:88503001-88503023 TTGTATTTTGTAATGGAGACAGG + Intergenic
1029202768 7:98850053-98850075 TTATTTATTTTTCTGGAGACAGG + Intronic
1029306837 7:99625764-99625786 TTTCTGACTGTTCTGGAGACTGG + Intronic
1029384804 7:100236586-100236608 TTGCATTTTTTTGTAGAGACAGG - Intronic
1029669766 7:102021477-102021499 TTGTATTTTTTTCTAGAGACGGG + Intronic
1029941445 7:104484671-104484693 TTTCTTATAGTTCTGGAGGCTGG + Intronic
1030195506 7:106849360-106849382 TGGCTTATGGTTCTGGAGGCTGG - Intergenic
1030331946 7:108280259-108280281 TTGCAGCTTGTTCTGGTGAAAGG - Intronic
1030385924 7:108868321-108868343 TTGCTTATAGTTCTGGAGACTGG + Intergenic
1030456897 7:109785947-109785969 TTGCATATAGATTTGAAGACTGG + Intergenic
1030502817 7:110381818-110381840 TTGCTCATGGTTCTGGAGGCTGG + Intergenic
1030589327 7:111461649-111461671 TTTCACTTTATTCTGGAGACTGG + Intronic
1031337625 7:120555323-120555345 TTGAATATGGTTTTTGAGACAGG + Intronic
1031908435 7:127487687-127487709 TTTCTTACAGTTCTGGAGACTGG - Intergenic
1031978874 7:128111472-128111494 TTGCTCATAGTTCTGGAGGCTGG + Intergenic
1032213505 7:129938237-129938259 TTGTATATTTTTGTAGAGACAGG - Intronic
1032247783 7:130227679-130227701 TTAAATATTTTTCTAGAGACAGG - Intergenic
1032380582 7:131475638-131475660 TTGCATGTTTTTGTAGAGACAGG - Intronic
1032731645 7:134648683-134648705 TTGCATTTTTTTTTTGAGACAGG + Intronic
1032822996 7:135541890-135541912 TTGCATTTTTTTGTAGAGACCGG - Intergenic
1032974229 7:137203361-137203383 TTTCTGATTGTTCTGGAGGCAGG - Intergenic
1033048446 7:137983015-137983037 TTTCTTACAGTTCTGGAGACTGG - Intronic
1033118311 7:138645546-138645568 TGGCATATTGCTGTGGAGGCTGG - Intronic
1033554962 7:142481210-142481232 TGGCTTATAGATCTGGAGACCGG - Intergenic
1033559569 7:142518741-142518763 TGGCTTATAGATCTGGAGACTGG - Intergenic
1034031796 7:147774738-147774760 TTTCTTCTAGTTCTGGAGACTGG - Intronic
1034056886 7:148044689-148044711 TTGCTTACAGTTCTGGAGGCTGG - Intronic
1034071417 7:148189643-148189665 TTGGCTGTGGTTCTGGAGACTGG - Intronic
1034166851 7:149031516-149031538 TTTCTTACAGTTCTGGAGACTGG - Intergenic
1034181733 7:149144478-149144500 TTGTATTTTTTTATGGAGACAGG + Intronic
1034339867 7:150345775-150345797 TTGTATTTTTTTCTAGAGACAGG + Intergenic
1035082527 7:156229104-156229126 TTGCTCACTGTTCTGGAGGCTGG + Intergenic
1035350448 7:158241871-158241893 GTGCATATGGTCCTGGAGAAGGG + Intronic
1036075828 8:5498640-5498662 TTTCACATAGTTCTGGAGGCTGG + Intergenic
1036114694 8:5946099-5946121 TTGCATTTTTTTGTAGAGACGGG + Intergenic
1036157230 8:6353757-6353779 TTGCATTTTTTTGTAGAGACGGG - Intergenic
1036475868 8:9092829-9092851 TGGCTTACAGTTCTGGAGACTGG + Intronic
1036800610 8:11788258-11788280 TTTCTTATAGTTCTGGAGCCTGG + Intergenic
1037365134 8:18114176-18114198 TAGCATATTATTCTGAAGTCAGG + Intergenic
1037415243 8:18643095-18643117 TTTCTTACAGTTCTGGAGACTGG + Intronic
1037534390 8:19811322-19811344 TTGCTTACAGTTCTGGAGACTGG + Intergenic
1037735344 8:21561437-21561459 TTGCTCATAGTTCTGGAGGCTGG + Intergenic
1037953934 8:23038649-23038671 TTGCATCCTCTTCTGGAGAAAGG + Intronic
1038277917 8:26137194-26137216 TTGCTCATGGTTCTGGAGGCTGG - Intergenic
1038380513 8:27088923-27088945 TTTCTTACTGTTCTGGAGGCTGG + Intergenic
1038484340 8:27922977-27922999 TTGCTCATGGTTCTGGAGGCTGG - Intronic
1038566042 8:28620884-28620906 TTGCTTATTTTTGTAGAGACTGG + Intronic
1038726315 8:30085274-30085296 TTTCTTATGGTTCTGGAGGCTGG - Intergenic
1038746009 8:30255597-30255619 TGGCTTACGGTTCTGGAGACTGG - Intergenic
1038753089 8:30315096-30315118 TTGTATATTTTTGTAGAGACAGG - Intergenic
1039235679 8:35500189-35500211 TTTCTTATAGTTCTGGAGACTGG + Intronic
1039359946 8:36865275-36865297 TTGCATATTGTTTTCCATACTGG - Intronic
1040016630 8:42705599-42705621 TGGCTTATGGTTCTAGAGACTGG - Intronic
1040021377 8:42744445-42744467 TTGCTGACAGTTCTGGAGACTGG + Intergenic
1040569054 8:48592147-48592169 GGGCAGAGTGTTCTGGAGACAGG + Intergenic
1040723749 8:50356523-50356545 TTTCATACAGTTCTGGAGTCTGG + Intronic
1040751875 8:50719452-50719474 TTTCTTACAGTTCTGGAGACTGG - Intronic
1040789654 8:51211322-51211344 CCTAATATTGTTCTGGAGACTGG - Intergenic
1040858784 8:51977576-51977598 TTGCTCATTGTTCTGGAGCCTGG - Intergenic
1041060893 8:54033373-54033395 TTGCATTTTTTTCTTGAGACAGG - Intergenic
1041714231 8:60919724-60919746 TTGCTCACAGTTCTGGAGACTGG + Intergenic
1041795735 8:61745982-61746004 TTGCTCATTGTTCTGGAGGTTGG + Intergenic
1041864436 8:62553707-62553729 TTGTATTTTCTACTGGAGACAGG + Intronic
1041868604 8:62606625-62606647 TTGCACATTGTTCTGGAAACAGG - Intronic
1042112906 8:65400129-65400151 TGGTTTATGGTTCTGGAGACTGG - Intergenic
1042203342 8:66303387-66303409 TGGCTTATGGTTCTGGAGGCTGG - Intergenic
1042280319 8:67049289-67049311 TTGTATCTTTTTGTGGAGACAGG - Intronic
1042365942 8:67936536-67936558 TTGCTCACTGTTCTGGAGGCTGG + Intergenic
1042474673 8:69233686-69233708 TTGCTCATAGTTCTGGAGGCTGG + Intergenic
1042561296 8:70073558-70073580 TTGTATATTTTTGTGGAGACAGG + Intergenic
1042739749 8:72030105-72030127 TTGCTTATGGTTCTGCAGGCTGG + Intronic
1042899922 8:73714908-73714930 TTGTATATTTTTGTAGAGACGGG - Intronic
1043394667 8:79824998-79825020 TTGTATTTTTTTGTGGAGACAGG + Intergenic
1043451390 8:80371053-80371075 TTTTATATTTTTGTGGAGACAGG + Intergenic
1044538521 8:93384449-93384471 TTGCTTATAGTTCTAGAGGCTGG + Intergenic
1044771902 8:95644907-95644929 ATGCAAATTGGTCTGGAGAAGGG + Intergenic
1045421625 8:102022194-102022216 TTCCATACTGTTCTGGATCCAGG - Intronic
1045864797 8:106852639-106852661 TTGCTCATAGTTCTGGAGGCTGG + Intergenic
1046148128 8:110189162-110189184 TGGCACAATTTTCTGGAGACAGG + Intergenic
1046622071 8:116538523-116538545 TTTCTTACAGTTCTGGAGACTGG - Intergenic
1046622437 8:116542686-116542708 TTGCATTTTTTTGTAGAGACTGG + Intergenic
1046722948 8:117641306-117641328 TTTCATATTTTTGTAGAGACTGG + Intergenic
1046926310 8:119792899-119792921 TTACTTCTTGTTCTGGAGGCTGG - Intronic
1047014660 8:120710784-120710806 TTTCTTATGGTTCTGGAGGCTGG - Intronic
1047032995 8:120903761-120903783 TTTCTTAGAGTTCTGGAGACTGG - Intergenic
1047372977 8:124271497-124271519 TTTCTTACAGTTCTGGAGACTGG - Intergenic
1047562255 8:126000197-126000219 TTTCTTATAGTTCTGGAGACTGG - Intergenic
1047612689 8:126536709-126536731 TTTCGTTTTGTTTTGGAGACAGG + Intergenic
1047850187 8:128848639-128848661 TTTCTCAGTGTTCTGGAGACTGG - Intergenic
1047870295 8:129074971-129074993 TTTCTCATGGTTCTGGAGACTGG + Intergenic
1048088324 8:131209089-131209111 TGGCTTATGGTTCTTGAGACTGG + Intergenic
1048141895 8:131802992-131803014 TTGCTTTTTGTTTTTGAGACAGG + Intergenic
1048285775 8:133140533-133140555 TGGCCTGTGGTTCTGGAGACTGG + Intergenic
1048651454 8:136483179-136483201 TTGCTCATTGTTCTAGGGACAGG + Intergenic
1048776235 8:137949679-137949701 TTTCTCATAGTTCTGGAGACTGG + Intergenic
1050197369 9:3100784-3100806 TTGTATTTTTTTCTAGAGACAGG + Intergenic
1051108841 9:13611863-13611885 TTGCTTATGGTTCTGGAGGCTGG + Intergenic
1052027431 9:23589094-23589116 TTGCTCACAGTTCTGGAGACTGG - Intergenic
1052338506 9:27342637-27342659 TTGCATTTTTTGGTGGAGACGGG + Intronic
1053578827 9:39381834-39381856 TTTCTTATCGTTCTGGAGGCTGG + Intergenic
1053843342 9:42209909-42209931 TTTCTTATCGTTCTGGAGGCTGG + Intergenic
1054100410 9:60940638-60940660 TTTCTTATCGTTCTGGAGGCTGG + Intergenic
1054121808 9:61216263-61216285 TTTCTTATCGTTCTGGAGGCTGG + Intergenic
1054585936 9:66966248-66966270 TTTCTTATCGTTCTGGAGGCTGG - Intergenic
1054919516 9:70527953-70527975 TTGCTTACAGTTCTGGAGGCTGG - Intergenic
1055231855 9:74075973-74075995 TTCCTTACAGTTCTGGAGACTGG + Intergenic
1055351298 9:75391494-75391516 TGGCTTACAGTTCTGGAGACTGG + Intergenic
1055416636 9:76091181-76091203 TTTCTTATAGTTCTGGAGGCTGG + Intronic
1055616899 9:78082350-78082372 TTTCTTATGGTTCTGGAGGCTGG - Intergenic
1055652625 9:78421499-78421521 TTGCATATTTTTGTAGAGATGGG + Intergenic
1055852102 9:80644307-80644329 TTGTATCTTTTTGTGGAGACAGG + Intergenic
1055899138 9:81214188-81214210 TTTCTTATAGTTCTGGAGGCTGG - Intergenic
1056115842 9:83440529-83440551 TTGTATATTGCCCTGGAGGCTGG - Intronic
1056335338 9:85563075-85563097 TTTCTTACAGTTCTGGAGACAGG - Intronic
1056418892 9:86404348-86404370 TTTCTTACTGTTCTGGAGGCTGG - Intergenic
1056442480 9:86634643-86634665 TTTCTCATTGTTCTGGAGGCTGG + Intergenic
1056540197 9:87564477-87564499 TTGCATATGGTGCTGGAGGCTGG + Intronic
1056955407 9:91077127-91077149 TGGCTTGTGGTTCTGGAGACTGG + Intergenic
1056987106 9:91373557-91373579 TTTCTCAATGTTCTGGAGACTGG + Intergenic
1057056299 9:91963800-91963822 TTGCATACAGTTCTGGAGACTGG - Intergenic
1057305042 9:93907274-93907296 TTTCTTATAGTTCTGGAGGCTGG - Intergenic
1057979206 9:99641816-99641838 ATGCTTATAGTTCTGGAGTCTGG + Intergenic
1058078585 9:100676493-100676515 TTTCTTATTGTTTTGGAGGCTGG + Intergenic
1058216085 9:102235455-102235477 ATGCATTTTGTTTTTGAGACAGG - Intergenic
1058541252 9:106014760-106014782 TTGCTCATAGTTCTGGAGGCTGG + Intergenic
1058608381 9:106748310-106748332 TTGCTTACAGTTCTGGAAACTGG + Intergenic
1058725359 9:107798220-107798242 TTTCTTACAGTTCTGGAGACTGG + Intergenic
1058886444 9:109324943-109324965 TTTCTTATAGTTCTGGAGGCTGG - Intergenic
1059304514 9:113343403-113343425 TGGCTCATGGTTCTGGAGACTGG + Intergenic
1059432390 9:114258024-114258046 TTTCTTATTTTTGTGGAGACAGG - Intronic
1059541343 9:115133365-115133387 TTTCTTATAGTTCTGGAGGCTGG + Intergenic
1059887221 9:118759532-118759554 TTTCTTATAGTTCTGGATACTGG + Intergenic
1059977664 9:119735566-119735588 TTGTATATTTTTGTAGAGACGGG - Intergenic
1060059653 9:120447684-120447706 TTTCATTTTATTCTGGAGTCTGG - Intronic
1060492700 9:124096677-124096699 TTGTATATTTTTGTAGAGACAGG + Intergenic
1060658023 9:125386265-125386287 TGGCACATGGTTCTGGAGGCTGG + Intergenic
1060731742 9:126041606-126041628 TTGCTTATGGTTCTGGAGGCTGG - Intergenic
1060837106 9:126764421-126764443 TTGTTTATTGTTTTTGAGACAGG + Intergenic
1061432267 9:130538568-130538590 TTGTATTTTTTTGTGGAGACAGG + Intergenic
1061525417 9:131157649-131157671 TTGTGTTTTGTTTTGGAGACAGG + Intronic
1061560599 9:131400256-131400278 TTGTATTTTTTTGTGGAGACGGG + Intronic
1061977177 9:134075330-134075352 TTGCATTTTTTGGTGGAGACAGG + Intergenic
1185516948 X:707202-707224 TTGCTCATAGTTCTGGAGGCTGG + Intergenic
1185881523 X:3745593-3745615 TTGCTCATGGTTCTGGAGGCTGG + Intergenic
1185957056 X:4502683-4502705 TTGCTCACTGTTCTGGAGGCTGG - Intergenic
1186082772 X:5951587-5951609 TTGCTCACAGTTCTGGAGACCGG + Intronic
1186211387 X:7253880-7253902 TTGCTCATAGTTCTGGAGGCTGG + Intronic
1186442734 X:9600205-9600227 TTGCTCATAGCTCTGGAGACTGG + Intronic
1186476955 X:9865005-9865027 TTGCTTTTTGTTTTTGAGACTGG - Intronic
1186645044 X:11497687-11497709 TTTCTCATAGTTCTGGAGACTGG - Intronic
1186724039 X:12337925-12337947 TTGCTTACAGTTCTGAAGACTGG + Intronic
1186766455 X:12775491-12775513 TTTCATTTTCTTCTGGAGAAAGG - Intergenic
1187192887 X:17053511-17053533 TTTCATTTTTTTCTAGAGACAGG + Intronic
1187877097 X:23813420-23813442 TTGCATTTTTTTGTAGAGACGGG + Intergenic
1188067251 X:25677879-25677901 TTGTATTTTTTTGTGGAGACAGG + Intergenic
1188141652 X:26558293-26558315 TTGTGTGTTCTTCTGGAGACCGG + Intergenic
1188214534 X:27459762-27459784 TTGTATTTTTTTGTGGAGACGGG - Intergenic
1188277450 X:28217808-28217830 TTGCTCACAGTTCTGGAGACTGG + Intergenic
1188294330 X:28429058-28429080 TTGTATTTTTTTGTGGAGACAGG - Intergenic
1188584547 X:31757508-31757530 TTGCTTATAGTTCTGGAGGCTGG + Intronic
1189256876 X:39646743-39646765 TTGCTCACAGTTCTGGAGACTGG - Intergenic
1189302624 X:39963335-39963357 TGGCTTACAGTTCTGGAGACTGG - Intergenic
1189367111 X:40397368-40397390 TTTCTTATGGTTCTGGAGGCTGG + Intergenic
1189714758 X:43853870-43853892 TGTCATATGGTTCTGGAGGCTGG - Intronic
1189919447 X:45889069-45889091 TTGCATATTTTTGTAGAGACAGG + Intergenic
1189963437 X:46347639-46347661 TTTCATATTTTTGTAGAGACAGG + Intergenic
1189980293 X:46503863-46503885 TTGTATTTTTTTGTGGAGACGGG - Intronic
1190015827 X:46826255-46826277 TTGCATTTTTTTGTAGAGACAGG + Intergenic
1190153537 X:47968200-47968222 TTGCTCATAGTTCTGGGGACTGG - Intronic
1190185412 X:48229357-48229379 TTGCATTTTTTTGTAGAGACAGG + Intronic
1190252677 X:48738911-48738933 TTGTATTTTTTTCTAGAGACGGG + Intergenic
1190309813 X:49109150-49109172 TTCCTTATAGTTCTGGAGGCTGG - Intergenic
1190417680 X:50197213-50197235 ATGAATATAGTTCTTGAGACTGG - Intronic
1190762905 X:53451347-53451369 TTGTATTTTTTTGTGGAGACAGG + Intergenic
1190825962 X:54018283-54018305 TTGAATTTTTTTGTGGAGACGGG - Intronic
1191014862 X:55798238-55798260 TTGCATTTTTTTGTGGAGACGGG - Intergenic
1191628924 X:63299959-63299981 TAGCTTATGGTTCTGGAGGCTGG + Intergenic
1191794673 X:65008383-65008405 TTGCATATTGTTCTCCATAGTGG - Intronic
1192372003 X:70522029-70522051 TTGTATTTTGTTGTAGAGACTGG + Intergenic
1192739790 X:73881857-73881879 TTGCATTTTTTGGTGGAGACGGG + Intergenic
1193213636 X:78837577-78837599 TTGCATATTTTGGTAGAGACGGG + Intergenic
1193723988 X:85019455-85019477 TTGCTTACAGTTCTGGAGGCTGG - Intronic
1194190055 X:90824521-90824543 TTTCTTATAGTTCTGGAGATTGG + Intergenic
1194979461 X:100425490-100425512 TTGCTGATAGTTCTGGAGGCTGG - Intergenic
1195539458 X:106046089-106046111 TTACAGACTGTTTTGGAGACAGG - Intergenic
1195576896 X:106461438-106461460 TTTCTTATAGTTCTGGAGGCTGG - Intergenic
1196828968 X:119761392-119761414 TTGTATATTTTTGTAGAGACAGG - Intergenic
1197373499 X:125654183-125654205 TTGTATATTTTTGTAGAGACAGG + Intergenic
1197563963 X:128058038-128058060 TTTCTCATTGTTCTGGAGTCTGG - Intergenic
1197611591 X:128645162-128645184 TTGAATATTGTTGGGGAAACAGG + Intergenic
1197817245 X:130510835-130510857 TTGTATTTTTTTCTAGAGACGGG - Intergenic
1197885074 X:131209929-131209951 TTTCTTATAGTTCTGGAGGCTGG - Intergenic
1197909727 X:131467807-131467829 TTGCATTTTGTCAAGGAGACTGG - Intergenic
1198053890 X:132975215-132975237 TTGCATTTTTTAGTGGAGACGGG + Intergenic
1198109441 X:133489852-133489874 TTGCATATTTTTTTTGAGAAAGG + Intergenic
1198601094 X:138285048-138285070 TTGCCCATAGTTTTGGAGACTGG + Intergenic
1198621935 X:138522066-138522088 TTGCTTACAGTTCTGGAGACTGG - Intergenic
1198752427 X:139949157-139949179 TTGCATTTTTTACTAGAGACGGG + Intergenic
1198802492 X:140461810-140461832 TTGCTTACAGTTCTGGAGGCTGG - Intergenic
1198818291 X:140616810-140616832 TTGCACATAGTTCTGGAGGCTGG + Intergenic
1198835316 X:140798682-140798704 TTTCTCATGGTTCTGGAGACTGG + Intergenic
1198948086 X:142038054-142038076 TAGCTTATGGTTCTGGAGGCTGG + Intergenic
1199343860 X:146715311-146715333 TTGTATTTTTTTGTGGAGACGGG + Intergenic
1199689349 X:150296485-150296507 TTTCTCATTGTTCTGGAGTCAGG - Intergenic
1200183375 X:154165422-154165444 TTGCATATTTTAGTAGAGACGGG - Intergenic
1200189029 X:154202536-154202558 TTGCATATTTTAGTAGAGACGGG - Intergenic
1200194784 X:154240394-154240416 TTGCATATTTTAGTAGAGACGGG - Intergenic
1200200434 X:154277480-154277502 TTGCATATTTTAGTAGAGACGGG - Intronic
1200274748 X:154721316-154721338 TTGCTCATGGTTCTGGAGACTGG + Intronic
1200393043 X:155963708-155963730 TTGCATATAATTCTGGAGCCTGG + Intergenic
1200804287 Y:7416273-7416295 TTTTAAATTTTTCTGGAGACAGG - Intergenic
1201480503 Y:14433418-14433440 TTGCCTATTGTTCTAGCTACAGG + Intergenic
1201497493 Y:14604260-14604282 TTGCTCACAGTTCTGGAGACTGG - Intronic
1201885003 Y:18872613-18872635 TTGCCCACAGTTCTGGAGACTGG + Intergenic