ID: 1110289854

View in Genome Browser
Species Human (GRCh38)
Location 13:73792158-73792180
Sequence GACTCACTGGTATGTTGGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 101
Summary {0: 1, 1: 0, 2: 2, 3: 7, 4: 91}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110289854_1110289862 10 Left 1110289854 13:73792158-73792180 CCAACCCAACATACCAGTGAGTC 0: 1
1: 0
2: 2
3: 7
4: 91
Right 1110289862 13:73792191-73792213 AATGTATACTCACGTCTTAGAGG 0: 1
1: 0
2: 0
3: 5
4: 73
1110289854_1110289863 30 Left 1110289854 13:73792158-73792180 CCAACCCAACATACCAGTGAGTC 0: 1
1: 0
2: 2
3: 7
4: 91
Right 1110289863 13:73792211-73792233 AGGAAAGCTGCTAGTTCTAGAGG 0: 1
1: 0
2: 0
3: 10
4: 102

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110289854 Original CRISPR GACTCACTGGTATGTTGGGT TGG (reversed) Intronic
902503744 1:16926464-16926486 CCCTCACTGGCATGTTGGGCTGG + Intronic
903396670 1:23006796-23006818 GACACACTGGTATGAAGGTTGGG - Intergenic
904303100 1:29568807-29568829 GTCTCCCTGGTCTGGTGGGTGGG + Intergenic
906455787 1:45995804-45995826 TACTCTCTGGGATGTTTGGTTGG + Intronic
912809413 1:112782688-112782710 GACACACTGGTATGAGGGGTGGG + Intergenic
914430923 1:147619808-147619830 GGCTCCCTGGCATGTTGGGGTGG - Exonic
917212006 1:172641080-172641102 AACTCAGTGGAATGTTAGGTGGG + Intergenic
917705745 1:177632884-177632906 GAGTCACTGGTATTTGTGGTTGG - Intergenic
918705703 1:187659375-187659397 GACTCATAGGTATCTTGAGTGGG - Intergenic
921290800 1:213655432-213655454 GACTCACAGGTATCTTATGTTGG - Intergenic
924686135 1:246292593-246292615 GAGTGACTGGTATGTTGGAGTGG - Intronic
1067858817 10:49822538-49822560 GACTAACTGGTAAGTGTGGTTGG + Intronic
1069844687 10:71362742-71362764 GGCTCACTGGCATCTTGGGAGGG - Exonic
1073917396 10:108421727-108421749 GATTCACTGTTATTTGGGGTAGG - Intergenic
1076275853 10:129197769-129197791 GACTCAGTGGTAGGTTGGCGGGG - Intergenic
1078778759 11:14417538-14417560 CACTCACTGGTAAGTGGAGTTGG - Intergenic
1078778966 11:14419301-14419323 CACTCACTGGTAAGTGGAGTTGG - Intergenic
1080282165 11:30569798-30569820 GATTCATTGGTATATTGAGTCGG + Intronic
1085954877 11:81379658-81379680 GAGGCAGTGGTTTGTTGGGTTGG + Intergenic
1095204209 12:39420859-39420881 GTATAACTGGTTTGTTGGGTGGG - Intronic
1100359590 12:93863738-93863760 GTGTTACTGGTATTTTGGGTGGG - Intronic
1107324982 13:39231981-39232003 GACTCACTGTTAATCTGGGTGGG - Intergenic
1110289854 13:73792158-73792180 GACTCACTGGTATGTTGGGTTGG - Intronic
1115791840 14:36888401-36888423 AAATCACAGGCATGTTGGGTGGG - Intronic
1118454408 14:65931620-65931642 GACTCAAGTGTATGTTGGGGTGG - Intergenic
1118879173 14:69811490-69811512 GACTCAGTGGAATGCTGAGTTGG - Intergenic
1118979802 14:70707222-70707244 GACTCTGTGCCATGTTGGGTGGG + Intergenic
1119628358 14:76203387-76203409 GACTCACAGGTCTGCTGGGCTGG - Exonic
1120934941 14:89886069-89886091 GACTCTCTGTTATGTTGCATTGG - Intronic
1121067412 14:90981383-90981405 GTCCCACTGATATGTTGTGTGGG + Intronic
1125498065 15:40216028-40216050 CACTCACTGTTACTTTGGGTAGG - Intronic
1125874480 15:43132042-43132064 GAATTACTGGTTTGTGGGGTGGG + Intronic
1130061664 15:80574860-80574882 GAATCACTGGCATTTTGGGCTGG - Intronic
1134602047 16:15541285-15541307 GACACACTGGTGTGCTGGGAGGG - Intronic
1140765593 16:78153998-78154020 GACTCACTGGTAGGTTGGACAGG - Intronic
1142809886 17:2390716-2390738 GCCTCACTGGTGGGTGGGGTTGG - Intronic
1148177486 17:45579887-45579909 AACTCCCTTGTATGTTGTGTTGG - Intergenic
1154322993 18:13369404-13369426 GCCTCAGTGGGCTGTTGGGTGGG + Intronic
1155247623 18:23925036-23925058 GAGTCACTGGGAGGTGGGGTGGG + Intronic
1156154657 18:34287555-34287577 CACACACTGGTATGAGGGGTGGG + Intergenic
1159560179 18:69985127-69985149 GAATAAATGGTATGTTGGCTGGG - Intergenic
1161733048 19:5973978-5974000 GACTCACTGGTATCGATGGTGGG - Intronic
1166658282 19:44627898-44627920 GACTCTCTGGGTTGTTGGGTTGG + Intronic
1168282814 19:55314607-55314629 GACTCAGTAGTCTCTTGGGTGGG - Intronic
1168448792 19:56446813-56446835 GACTTAATGGGATGTGGGGTGGG - Intronic
925156272 2:1651009-1651031 CACACCCTGGTGTGTTGGGTGGG + Intronic
926641892 2:15245845-15245867 GACACTCTGGTTTGTTTGGTTGG + Intronic
931756172 2:65376549-65376571 GTACCACTGGCATGTTGGGTAGG - Intronic
934121466 2:88844315-88844337 AACTCACTGGTATTTTGGCTGGG + Intergenic
935078372 2:99768442-99768464 GACCCATTTGTATGTTGTGTTGG - Intronic
943272520 2:185825362-185825384 GACTCAGAGGAATGTTGGATGGG - Intronic
943335346 2:186606810-186606832 GAATCACTGCTGGGTTGGGTCGG - Intronic
948363890 2:237442110-237442132 GATTCACTGTCATGGTGGGTGGG + Intergenic
948725984 2:239934286-239934308 GAGTCACTGCCATGTTGGGAGGG + Intronic
1169164993 20:3415385-3415407 GGCACACTGGTATGAGGGGTGGG + Intergenic
1173801389 20:45896791-45896813 GACTGACTTGGATGTTGGGCTGG - Intronic
1178836142 21:36099195-36099217 TACTGACTGTTCTGTTGGGTTGG - Intergenic
1183307602 22:37090996-37091018 GACTCACTGGTGTGTGGGGTAGG - Intronic
953504605 3:43472410-43472432 AAGTCACTGATATGGTGGGTAGG + Intronic
961946464 3:130694951-130694973 TACTAACTGGTTTGTTGAGTTGG + Intronic
965794321 3:172423125-172423147 GACTCACAGGTTTGTAGGGCTGG - Intergenic
969420934 4:7095501-7095523 GACTCACTGTCATCATGGGTGGG - Intergenic
969997042 4:11323992-11324014 GACTAACTGGTTTATTGGATAGG + Intergenic
981748035 4:148069431-148069453 GTCTCTCTGGTTTGTTGGTTGGG + Intronic
983526558 4:168766096-168766118 GATTCAGGGGTGTGTTGGGTGGG - Intronic
989014615 5:36915836-36915858 GACTTCCTGGTATGTTCAGTTGG - Intronic
999653639 5:153792058-153792080 AGCTCATTGGTATGTTGGCTGGG - Intronic
1000031446 5:157405748-157405770 CACTCACTGATTTCTTGGGTTGG - Intronic
1001446454 5:171787775-171787797 GAATCACTGCTATGAAGGGTGGG - Intronic
1003439308 6:6124324-6124346 GGCACACTGGTATGTTGGGTGGG - Intergenic
1007271231 6:40638818-40638840 GACTCACTGGTAGGTGAGGTGGG - Intergenic
1009043114 6:58205324-58205346 TATTCACAGGAATGTTGGGTGGG - Intergenic
1009218951 6:60959573-60959595 TATTCACAGGAATGTTGGGTGGG - Intergenic
1016337359 6:143021692-143021714 GACTCAGTGGTATTCGGGGTGGG - Intergenic
1016869894 6:148806699-148806721 GACTCACTGGTCTGGAGGCTGGG + Intronic
1018773314 6:166991545-166991567 GACTCACTCATATGTTAGGGAGG - Intergenic
1022188472 7:27993580-27993602 GGCACATTGGTATGCTGGGTGGG + Intronic
1028684499 7:93576227-93576249 AAATCCCTGGAATGTTGGGTGGG - Intergenic
1031788047 7:126059279-126059301 GACTCACAGGTCTGCAGGGTTGG - Intergenic
1033511525 7:142064507-142064529 GACTCACTCGTATGTGGGTCTGG - Exonic
1033514588 7:142093535-142093557 GACTCACTCGTATGTGGGTCTGG - Intronic
1034190934 7:149213158-149213180 CTCTCCCTGGTATGGTGGGTAGG - Intronic
1037411727 8:18605256-18605278 GGCACACTGGTATGAGGGGTAGG - Intronic
1037609463 8:20464117-20464139 GACTCAGTGGTGAGTTTGGTTGG + Intergenic
1038525782 8:28271981-28272003 GTCTCAGTGGTCTTTTGGGTAGG - Intergenic
1039268247 8:35852142-35852164 TATTCAGTGGGATGTTGGGTGGG + Intergenic
1040335309 8:46413013-46413035 GACTCAGTGGGATGTTGGGCAGG + Intergenic
1041957033 8:63567501-63567523 GACTCACTGGTTTCAGGGGTAGG - Intergenic
1043584087 8:81747457-81747479 CACTTCCGGGTATGTTGGGTGGG + Intronic
1048903842 8:139067852-139067874 GAAACAGTGGCATGTTGGGTGGG + Intergenic
1050038190 9:1460265-1460287 GACTCCCAGGTATGATGGGAAGG + Intergenic
1054784765 9:69200239-69200261 GACTAACTGGTCAGGTGGGTGGG - Intronic
1056388159 9:86116399-86116421 GAGTCACTGCCATTTTGGGTGGG + Intergenic
1056733008 9:89181967-89181989 GAATCCCTGGTAGGTTGGTTGGG + Intergenic
1058594340 9:106599534-106599556 AACTCACTGGTATCCTGGGCAGG + Intergenic
1059045312 9:110860552-110860574 GACTCACAGTTATGCTGGATTGG - Intergenic
1059343268 9:113611696-113611718 GACACACTGGGATGGTGGGTGGG + Intergenic
1060019633 9:120117868-120117890 GACACACTGGTGTGAGGGGTGGG - Intergenic
1187195384 X:17078545-17078567 TAGTGACTGGTATGTAGGGTGGG + Intronic
1189507474 X:41626295-41626317 GACTGACTAGGATGTTGGATTGG + Intronic
1190528705 X:51353441-51353463 GATTCACTGGTTTGTTCAGTTGG - Intergenic