ID: 1110294421

View in Genome Browser
Species Human (GRCh38)
Location 13:73846096-73846118
Sequence GATACTGATGTGATAACAGT TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 138}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110294420_1110294421 13 Left 1110294420 13:73846060-73846082 CCTGGAGTTAATACTGTTGACGA 0: 1
1: 0
2: 0
3: 6
4: 38
Right 1110294421 13:73846096-73846118 GATACTGATGTGATAACAGTTGG 0: 1
1: 0
2: 0
3: 1
4: 138
1110294418_1110294421 24 Left 1110294418 13:73846049-73846071 CCACAAGGGGCCCTGGAGTTAAT 0: 1
1: 0
2: 0
3: 5
4: 123
Right 1110294421 13:73846096-73846118 GATACTGATGTGATAACAGTTGG 0: 1
1: 0
2: 0
3: 1
4: 138
1110294419_1110294421 14 Left 1110294419 13:73846059-73846081 CCCTGGAGTTAATACTGTTGACG 0: 1
1: 0
2: 0
3: 0
4: 49
Right 1110294421 13:73846096-73846118 GATACTGATGTGATAACAGTTGG 0: 1
1: 0
2: 0
3: 1
4: 138

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110294421 Original CRISPR GATACTGATGTGATAACAGT TGG Exonic
905496743 1:38395246-38395268 ATTACTGATGTGATAATATTAGG + Intergenic
907865865 1:58398490-58398512 GGTACAGATGTGAAAACAGAGGG - Intronic
914098401 1:144563516-144563538 GATGCTGATCTGACAAGAGTCGG + Intergenic
915777465 1:158506534-158506556 GATATTGCTGTGGTGACAGTAGG - Intergenic
917262835 1:173188554-173188576 GATACCGATGTGATACCTGAGGG + Exonic
917303450 1:173603067-173603089 GATTTTGGTGTGATATCAGTTGG - Exonic
919027184 1:192188822-192188844 GATACTGATTTGATCTCACTTGG - Intergenic
919463614 1:197907532-197907554 AACACTGATGAGAAAACAGTAGG - Intergenic
922326253 1:224531153-224531175 GACACTGATGTGACTACAGCTGG - Intronic
1067182618 10:44000415-44000437 GGTGGTGATGTGATAACTGTGGG - Intergenic
1070163370 10:73879756-73879778 GGTACTGATGTGACGACAGGCGG + Intergenic
1073689812 10:105795910-105795932 GATGCTATTGTGATAAGAGTGGG + Intergenic
1074409331 10:113211649-113211671 GATTAGGATGTGAAAACAGTTGG - Intergenic
1074702153 10:116101993-116102015 GACACTGAAATCATAACAGTAGG - Intronic
1081423001 11:42894332-42894354 GATAAAGATGTGATTAGAGTAGG - Intergenic
1082616705 11:55370314-55370336 GATACTGGAGTGAGCACAGTGGG + Intergenic
1084300967 11:68252191-68252213 GAAACTGAGGTGATAAATGTGGG + Intergenic
1084837804 11:71816629-71816651 GGTATGAATGTGATAACAGTGGG - Intergenic
1086083212 11:82926973-82926995 TATTATGATATGATAACAGTGGG - Intronic
1087094585 11:94306883-94306905 GAGACTGTTCTGACAACAGTGGG + Intronic
1087592564 11:100209993-100210015 TATAAAGCTGTGATAACAGTAGG + Intronic
1091845167 12:3650195-3650217 GATACTGATGGGGTGGCAGTGGG - Intronic
1092777221 12:11954247-11954269 GATAATGCTATGAAAACAGTAGG + Intergenic
1093137986 12:15474721-15474743 GAAACTGATCTGATAAATGTAGG - Intronic
1093899067 12:24608800-24608822 GATAATGAAGTGATAAAAGGAGG - Intergenic
1094131675 12:27081736-27081758 GGGACTGACGTGATACCAGTGGG - Intronic
1095619537 12:44233743-44233765 GACACTAATGTGATAAAATTTGG - Intronic
1100079286 12:90828034-90828056 GACACATAGGTGATAACAGTGGG + Intergenic
1107210490 13:37848380-37848402 GATGGTGCTGTGATAGCAGTTGG - Intronic
1107351761 13:39522093-39522115 GAAAGTGATGTGACAAAAGTTGG - Intronic
1108856286 13:54797509-54797531 CATACTGAGCTGTTAACAGTTGG + Intergenic
1110294421 13:73846096-73846118 GATACTGATGTGATAACAGTTGG + Exonic
1112084368 13:96014871-96014893 GATACTGATTTGATAAAATCAGG - Intronic
1112604989 13:100895733-100895755 GATATGGAGGTGAAAACAGTGGG + Intergenic
1112922675 13:104634825-104634847 CATAATGGTGTGAAAACAGTAGG - Intergenic
1115226330 14:31105907-31105929 CAGACAGATTTGATAACAGTTGG - Intronic
1117397023 14:55320844-55320866 GATACTGTTGAGATAGCAGATGG + Intronic
1118452132 14:65912803-65912825 GATTCTCATGTTTTAACAGTGGG + Intergenic
1121416473 14:93782705-93782727 GATCCTTTTGTGAGAACAGTTGG - Intronic
1202909168 14_GL000194v1_random:101275-101297 GGGACTGGTGTGAAAACAGTCGG - Intergenic
1127888538 15:63226395-63226417 GATACTGAAGTCAGAAAAGTGGG - Intronic
1128950939 15:71881048-71881070 AATACTTCTGTGATAACATTTGG + Intronic
1133178532 16:4034779-4034801 GAGACTGAAGTGATAACATAAGG + Intronic
1138155022 16:54695019-54695041 GATGCTGATGGCAAAACAGTTGG - Intergenic
1140872528 16:79120369-79120391 GGTACAGATGGGGTAACAGTGGG + Intronic
1149545854 17:57503390-57503412 AACACTGAAGTGTTAACAGTGGG + Intronic
1152789359 17:82270440-82270462 GATACCAAAGTGACAACAGTAGG + Intronic
1161635027 19:5382846-5382868 GATACTTTTGTGCTAACAGCAGG - Intergenic
1163075357 19:14886204-14886226 GAAACTGATGTGTTCAGAGTTGG - Intergenic
1164011634 19:21208037-21208059 AATATTGTTGTGATAACTGTGGG + Intergenic
1165476962 19:36036203-36036225 GATTCTCAGGTGATAGCAGTTGG - Intronic
1202652615 1_KI270707v1_random:20607-20629 GGGACTGGTGTGAAAACAGTCGG - Intergenic
930541968 2:52717731-52717753 GATACAGGTGTTATAACAATGGG + Intergenic
935545460 2:104395651-104395673 GATACGGATGTGATGATTGTCGG - Intergenic
941577420 2:167250753-167250775 GATTCTATTGTGATAAAAGTTGG - Exonic
942313642 2:174679554-174679576 GATGCTGATGTGCTACCAGAGGG - Intronic
943993557 2:194730396-194730418 GATTCTTAAGTGACAACAGTTGG + Intergenic
944587597 2:201186278-201186300 GATGCTAATGAGATAAGAGTTGG + Intronic
944991844 2:205246783-205246805 GATTCTCTTGTGATAACAGCAGG + Intronic
1168852579 20:986695-986717 GATACTGAAGTTGTAACAGAGGG - Intronic
1169994988 20:11546400-11546422 GACACTGAGGAGATGACAGTGGG + Intergenic
1170063508 20:12285679-12285701 GGTACTGAAGTGATTCCAGTGGG + Intergenic
1171092421 20:22297691-22297713 GATACTGATTGCATAACAGATGG + Intergenic
1173170466 20:40719376-40719398 GACACTCATGTGACAACTGTGGG - Intergenic
1174486320 20:50863668-50863690 GACTCTGATGTGACAGCAGTTGG + Intronic
1175350575 20:58315215-58315237 CATACTGATTTGATAAAAGCTGG + Intronic
1176599537 21:8779047-8779069 GGGACTGGTGTGAAAACAGTCGG + Intergenic
1176628522 21:9115988-9116010 GGGACTGGTGTGAAAACAGTCGG - Intergenic
1177112336 21:17043394-17043416 GATAGTTATGAGATACCAGTTGG - Intergenic
1177322754 21:19544021-19544043 CATACTGATGAGATAACTGATGG + Intergenic
1179019725 21:37627576-37627598 AATAGGGCTGTGATAACAGTTGG + Intronic
1180418899 22:12795859-12795881 GGGACTGGTGTGAAAACAGTCGG - Intergenic
1180864060 22:19105797-19105819 GTTTGTGATGTGATCACAGTTGG - Intronic
1182191412 22:28464740-28464762 GAAAATGAAGTGATAACAGAGGG - Intronic
1182755386 22:32674923-32674945 GATCCTGATATGATTATAGTTGG + Intronic
950351298 3:12356329-12356351 GATTCTGAGGTTATAAGAGTTGG - Intronic
951319219 3:21224803-21224825 TATCCTGTTGTGATAACAGAAGG - Intergenic
951596949 3:24328853-24328875 GATATTAATCTGATAGCAGTAGG - Intronic
954695964 3:52426359-52426381 TATACTAATGTGTTAATAGTAGG - Intergenic
955483507 3:59413165-59413187 GATACTTATGTGCTGAGAGTGGG + Intergenic
957137373 3:76306840-76306862 GAAACTGAACTGAAAACAGTGGG - Intronic
958148890 3:89663455-89663477 GATAGTGATGAGATGAAAGTGGG + Intergenic
962899679 3:139749269-139749291 GAGAGTAATGTAATAACAGTAGG - Intergenic
971108575 4:23556016-23556038 GATACTAAAGAGATAACATTTGG - Intergenic
973362888 4:49181418-49181440 GGGACTGGTGTGAAAACAGTCGG + Intergenic
973398211 4:49615436-49615458 GGGACTGGTGTGAAAACAGTCGG - Intergenic
977837490 4:101662415-101662437 GATGCTGCTGTTATAACACTGGG + Intronic
978680573 4:111376850-111376872 GCCACTGATGTGATAAGAGGTGG + Intergenic
979294909 4:119021088-119021110 GATATTGATGTGTCAGCAGTGGG + Intronic
980102536 4:128555728-128555750 TTTACTGATGTGGTAACAGGAGG - Intergenic
982159995 4:152558762-152558784 GATACTGATTTGAAAATACTGGG - Intergenic
986356828 5:6936959-6936981 TAAAGTTATGTGATAACAGTGGG - Intergenic
986648475 5:9941231-9941253 GATAATGATGTGTTAAGTGTAGG - Intergenic
989593533 5:43134461-43134483 TATATTGAAGTGATAAGAGTAGG - Intronic
991077816 5:62561389-62561411 GATAATGATGTGGTAAATGTTGG + Intronic
994725109 5:103426143-103426165 GTTACTGATATGATCACAGATGG - Intergenic
996506462 5:124273308-124273330 TAAACTGATATGAAAACAGTGGG + Intergenic
1009821561 6:68808817-68808839 GATACTTTTCTGATAACAGCTGG - Intronic
1011900021 6:92281981-92282003 CATTCTGATTTGATAACATTTGG - Intergenic
1012155553 6:95815421-95815443 GATACAGCTGTGAGGACAGTTGG + Intergenic
1012946616 6:105473088-105473110 GGAACTGTTATGATAACAGTGGG - Intergenic
1017625018 6:156339283-156339305 AATACTGATGTGGGAACAGAAGG - Intergenic
1017759899 6:157560243-157560265 GCAACTGATGTGGCAACAGTCGG - Intronic
1021593745 7:22293125-22293147 GTGATTGAGGTGATAACAGTGGG - Intronic
1022830540 7:34061143-34061165 TTTACTTATGTGATAACATTGGG - Intronic
1025010683 7:55395105-55395127 GACACTGTTGGGATAAAAGTTGG + Intronic
1030867160 7:114713684-114713706 GATACTAATGAGACCACAGTAGG - Intergenic
1031329399 7:120445695-120445717 GAAACTAGTGTGATAACTGTTGG - Intronic
1034313171 7:150108073-150108095 CATAGTGATCTGATAGCAGTGGG + Intergenic
1039141980 8:34400830-34400852 GATGCTGAAGTAATATCAGTAGG - Intergenic
1040470581 8:47732847-47732869 GCTGCAGATGTGAAAACAGTAGG + Intronic
1043825234 8:84920177-84920199 GAAGTTGATGGGATAACAGTAGG + Intronic
1044068877 8:87730604-87730626 GATATTTATGTGATAAAAGAAGG + Intergenic
1045526985 8:102949304-102949326 GAGACTGATGGGTGAACAGTTGG - Intronic
1046370411 8:113298340-113298362 GACATTGATATGATAATAGTGGG + Intronic
1048116322 8:131527533-131527555 GTTACACATGTGATAACAGATGG + Intergenic
1050712650 9:8483299-8483321 GACACTGATGTATTAAAAGTAGG - Intronic
1051077236 9:13253609-13253631 GATACCTGAGTGATAACAGTGGG + Intronic
1051536320 9:18162330-18162352 CATACTCATGTGATTACATTGGG + Intergenic
1051706061 9:19881122-19881144 TATACTTATGTGATAATAATAGG - Intergenic
1051706306 9:19884041-19884063 TATACTCATGTGATAATAATAGG + Intergenic
1053502279 9:38608878-38608900 GGTACAGATGTGATAACAAAAGG + Intergenic
1056631977 9:88301455-88301477 GAGACTGATGTGATAGCCCTGGG - Intergenic
1057153759 9:92820420-92820442 GGTACAGATGTGATAACAAAAGG - Intergenic
1057681677 9:97193325-97193347 GGTACAGATGTGATAACAAAAGG + Intergenic
1058978123 9:110143608-110143630 GATACTAAAGTGAGAACTGTTGG - Intronic
1059191404 9:112330448-112330470 GTTACAGATCTTATAACAGTCGG - Intronic
1059295301 9:113265062-113265084 GATTATGATGTGACAAAAGTTGG - Intronic
1060475812 9:123985732-123985754 GTTACAGACGTGATAACAGGAGG + Intergenic
1062444793 9:136589065-136589087 CATCTTGATGTGATGACAGTGGG + Intergenic
1203751367 Un_GL000218v1:83667-83689 GGGACTGGTGTGAAAACAGTCGG - Intergenic
1186823010 X:13310961-13310983 GATACTGAAGTTATAAAGGTAGG + Intergenic
1188871532 X:35379355-35379377 GATACCAATATAATAACAGTGGG - Intergenic
1189856831 X:45232140-45232162 GATTCTGAAGTGCTAACAGTTGG - Intergenic
1190814474 X:53917124-53917146 GATATTGATTTTATTACAGTGGG + Intergenic
1193744218 X:85255414-85255436 GAGACTGATGTAGTAACAGAAGG + Exonic
1195720392 X:107861766-107861788 GCTACTGGTGAGTTAACAGTAGG + Intronic
1197858849 X:130948465-130948487 GGTCCTGATGTGGAAACAGTAGG + Intergenic
1198725824 X:139676075-139676097 GACACTGCTGTGTTAGCAGTAGG + Intronic
1201694174 Y:16806590-16806612 GCCACTGATGTGATAAGAGGCGG - Intergenic