ID: 1110303080

View in Genome Browser
Species Human (GRCh38)
Location 13:73952146-73952168
Sequence CAGAAAAGTTACTTGGAGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 294
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 281}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110303080 Original CRISPR CAGAAAAGTTACTTGGAGTC AGG Intronic
902114249 1:14107859-14107881 CAGGTAGGTTTCTTGGAGTCAGG - Intergenic
902524689 1:17048801-17048823 CAGAAGAATCACTTGAAGTCGGG - Intronic
903273133 1:22204528-22204550 CAGAACAGTTATTTGGACTCAGG - Intergenic
904188124 1:28721911-28721933 CAGAAGAATTACTTGAACTCGGG - Intergenic
906556939 1:46721647-46721669 CAGAAATGGTTCTTGAAGTCAGG - Intergenic
906796428 1:48699816-48699838 CAAAAAAATTACTTGCATTCAGG + Intronic
906808963 1:48807133-48807155 CAGAAAACTTCCTGGGAGTGCGG - Intronic
910722503 1:90302158-90302180 CGCAAAAGTTACTTGGAAACAGG - Intergenic
910847532 1:91617739-91617761 CAGAAAATCTGCTTGGAGGCTGG - Intergenic
911218297 1:95219433-95219455 GAGTAAAGTTACTTTGAGTTGGG - Intronic
911350156 1:96744129-96744151 CAGAAAAATTACTTGAACCCGGG + Intronic
912626149 1:111205583-111205605 CAGAAAAGGTACTTGGGGAAGGG - Intronic
912990417 1:114480942-114480964 AAAAAAAGATTCTTGGAGTCCGG + Intronic
913208769 1:116566015-116566037 TTCAAAAGTTACTTGGATTCTGG - Intronic
913222571 1:116670820-116670842 CAGAGAAGTGAATTGGAGGCTGG + Intergenic
915422387 1:155794162-155794184 CAGAAAAATTGCTTGAACTCAGG - Intronic
915793182 1:158697561-158697583 CTGAAGAGAAACTTGGAGTCTGG + Intergenic
917365171 1:174223348-174223370 CAGAAAAGTCACTTGAACCCAGG + Intronic
917464624 1:175265001-175265023 CAGAGAAGTTACATGAAGTAAGG + Intergenic
917554935 1:176075067-176075089 CAGACGTGTTACTTGGATTCAGG - Intronic
917800871 1:178569031-178569053 CAGAAAAATCACTTGAACTCAGG + Intergenic
919227876 1:194731062-194731084 AAGAAAAGATACTTGCAGTCAGG - Intergenic
920648851 1:207822122-207822144 CAGAAAAGTCAGTGGGAGACGGG - Intergenic
922358032 1:224795295-224795317 CAGAGATGCTACCTGGAGTCAGG + Intergenic
922668196 1:227490440-227490462 CAGAAAAGCTCCCCGGAGTCAGG + Intergenic
923494027 1:234509185-234509207 TAGAAAAGCTACTTGGGGCCGGG + Intergenic
924297894 1:242607298-242607320 CAGAAAAATCACTTGAACTCAGG - Intergenic
1062786906 10:272246-272268 CAGAAAAGTCACTTGAACCCGGG + Intergenic
1063320670 10:5049905-5049927 CTGGAAAGTTCCATGGAGTCAGG - Intronic
1063326234 10:5105888-5105910 CTGGAAAGTTCCATGGAGTCAGG - Intronic
1064354205 10:14603720-14603742 AGGAAAAGTTACTTGCAGACTGG + Intronic
1066998287 10:42583368-42583390 CAGAAAACTTACCTAGATTCTGG - Intronic
1071563433 10:86659734-86659756 CAGAAAACTTTCTGGAAGTCAGG + Intronic
1072060468 10:91805092-91805114 AAAAAAAGTTGCTTGGAGTTTGG - Intronic
1072158008 10:92741335-92741357 GAGAAAAGTTACAAGGAGGCTGG + Intergenic
1073413112 10:103358906-103358928 CAGAAGAATTGCTTGGAGCCAGG + Intergenic
1073920126 10:108449190-108449212 CAGAAAAGTTGCTTGAACCCAGG - Intergenic
1074792788 10:116908117-116908139 CAGAAAAGTAACCTGTTGTCAGG + Intronic
1074935033 10:118169767-118169789 CAGAAAAATTGCTTGGACCCGGG + Intergenic
1077395605 11:2319438-2319460 CAGAAGAATCACTTGAAGTCAGG + Intergenic
1078715689 11:13836958-13836980 CAGACAAGTTACTTGTCCTCTGG + Intergenic
1078756136 11:14212173-14212195 CAGAATAATTAGATGGAGTCCGG + Intronic
1078939588 11:15986826-15986848 CACTAAAGATACTTGGAGTTTGG - Intronic
1079832953 11:25293520-25293542 CATAAAAATAACTTGGATTCCGG + Intergenic
1080483315 11:32676474-32676496 CAGAAAAATTACTTGAATTTTGG - Intronic
1080685226 11:34509720-34509742 CAGAAAAGTTCCTTTAAGTGAGG + Intronic
1080910124 11:36588483-36588505 CAGATTAGTTTCTGGGAGTCAGG + Intronic
1081276767 11:41159055-41159077 CAGAAATGTTGCTTGAGGTCAGG + Intronic
1081365236 11:42226909-42226931 CAGGAAAGATACTTTGAGTAAGG - Intergenic
1081803198 11:45873840-45873862 CTGAAAAGTGAATTGGATTCAGG + Intronic
1082049074 11:47755354-47755376 CAGAAAAATTGCTTGAACTCGGG + Intronic
1083091406 11:60202706-60202728 CAGAACAGGCACCTGGAGTCAGG - Intronic
1083140903 11:60720774-60720796 CCGAAAGGTTACTTGCAGTGTGG - Intergenic
1083374978 11:62212540-62212562 CAGAAGAATTACTTGAAGCCAGG + Intronic
1084018266 11:66400084-66400106 CAGAAGAGTCACTTGTACTCGGG + Intergenic
1085059459 11:73431247-73431269 CAGGAAAGTCACTTGAACTCGGG + Intronic
1085839379 11:79993575-79993597 CAGAAAAGACACTTGGGGTCAGG - Intergenic
1086607436 11:88712668-88712690 CAGAAAATAGACTAGGAGTCAGG + Intronic
1092424555 12:8363912-8363934 TAGAAATGTTATTTGGAGGCAGG + Intergenic
1092447464 12:8570439-8570461 CAGGAGAGTTACTTGCAGTGAGG + Intergenic
1092756874 12:11771859-11771881 CAAGAATGTAACTTGGAGTCAGG + Intronic
1095188367 12:39227731-39227753 AAAAAAACTTACTTGCAGTCAGG - Intergenic
1098316423 12:69198188-69198210 CAGAAGACTTACTTTGTGTCTGG - Intergenic
1099894340 12:88625885-88625907 CAGAAAAATCAATGGGAGTCAGG + Intergenic
1100251854 12:92834314-92834336 CAGAAAGATTACTTGAGGTCAGG + Intronic
1100566346 12:95797620-95797642 CAAAAAAGTGACTTGGATTGGGG + Intergenic
1100584108 12:95963448-95963470 TCTAAAAGTTACTTGGAGCCTGG - Intronic
1101533811 12:105599197-105599219 CAAAAATGTTCCTTGGAGTTTGG - Intergenic
1102902298 12:116647780-116647802 CACAGAAGTCACATGGAGTCGGG - Intergenic
1104084894 12:125465529-125465551 CAGGAAAGTATCTTAGAGTCTGG + Intronic
1104588605 12:130066942-130066964 CAGAAAAGCTCCTGGGACTCTGG - Intergenic
1104701371 12:130906984-130907006 CAGAAGGATTACTTGAAGTCAGG - Intergenic
1105454658 13:20528925-20528947 CAGTTAAGTTACCTGGAATCTGG - Intergenic
1105822539 13:24092463-24092485 CAGAAGAGTTAATAGGAGCCAGG + Intronic
1106562082 13:30855569-30855591 CAGAAAAGTTCCCAGGAGTCTGG + Intergenic
1106812109 13:33368846-33368868 CAGAAGAGTTTCCTGGAGGCCGG - Intergenic
1107591060 13:41906314-41906336 CAGAAGTGTGAGTTGGAGTCTGG - Intronic
1107704558 13:43087678-43087700 CAGAAAAGTTCCTTGGGGGTGGG - Intronic
1108620501 13:52178761-52178783 CAAAAGAGATACTTGGATTCCGG - Intergenic
1108651551 13:52485312-52485334 CAGAAAAATTGCTTGAACTCGGG + Intergenic
1109476378 13:62885051-62885073 CAAAAAAGGTACTTGGAAACTGG + Intergenic
1110303080 13:73952146-73952168 CAGAAAAGTTACTTGGAGTCAGG + Intronic
1114979517 14:28145090-28145112 CAAAACTGTTACTTGGAGTTAGG + Intergenic
1116091008 14:40307136-40307158 CAGAAATGGTACTTTGAGTTGGG + Intergenic
1116952434 14:50892057-50892079 CAGAAAACTTGCTGGGACTCTGG + Intronic
1118094153 14:62517637-62517659 CAGAAAAGGCACTTGCAGTAAGG - Intergenic
1118874768 14:69774370-69774392 CAGATAGATTATTTGGAGTCAGG - Intergenic
1120302181 14:82721840-82721862 CAGAAAGATTACTTGAGGTCAGG + Intergenic
1120786706 14:88544758-88544780 CAGACAAATTCCTTTGAGTCAGG - Intronic
1122966553 14:105130771-105130793 CAGAAATGTAACTTGGGGCCAGG + Intergenic
1124913233 15:33943730-33943752 CAGAAGAGTCACTTGAACTCAGG + Intronic
1126004626 15:44244385-44244407 CAGAAAAGTGACCTGTAGGCTGG - Intergenic
1127091659 15:55472936-55472958 CAGGCAAATTACTTGAAGTCAGG + Intronic
1127343989 15:58076118-58076140 CAGAAAAGGTACATGGAATCAGG - Intronic
1128006036 15:64242401-64242423 AAGAAGAGTGACTGGGAGTCGGG - Intronic
1128424436 15:67525604-67525626 CTGAAATCTTACTTGGAGTTAGG + Intronic
1129855682 15:78823057-78823079 CAGAAAAATCACTTGAACTCGGG + Intronic
1130610789 15:85359101-85359123 CAGAAAAGTTGCTTGAACCCAGG + Intergenic
1130986070 15:88845526-88845548 CAGAAAACTTCTTTGGAGTGGGG + Exonic
1132031851 15:98444941-98444963 CAAAAAAGCAACTTGGGGTCGGG + Intronic
1133373691 16:5266083-5266105 CAGAAATGTCATTTGGAGGCAGG - Intergenic
1133596766 16:7301363-7301385 CATCAAAATTATTTGGAGTCGGG - Intronic
1133624377 16:7557026-7557048 TTGAACAGTTATTTGGAGTCAGG + Intronic
1136544424 16:30947656-30947678 AAGACCAGTTACTTGGAGTGGGG + Exonic
1138357913 16:56400125-56400147 CAAAAAAGTAGCTTGGACTCTGG - Intronic
1140089174 16:71823047-71823069 CAGAAAAGTTAAGAAGAGTCCGG + Intergenic
1141748797 16:85944607-85944629 CTGAACAGCTATTTGGAGTCTGG + Intergenic
1141776224 16:86124187-86124209 CAGAAGAATTACTTGAAGTCGGG + Intergenic
1143335915 17:6171388-6171410 CAGAGAAGTGACTTGGGGTGGGG - Intergenic
1144145659 17:12395583-12395605 CTGAAAAGGTAGTTGGATTCTGG + Intergenic
1149523954 17:57339796-57339818 TGGAAAAGTTTCTGGGAGTCAGG - Intronic
1149921847 17:60667622-60667644 CAGAAGAGTCACTTGAACTCGGG + Intergenic
1150059778 17:62056588-62056610 AAAAAAAGTTTTTTGGAGTCAGG - Intronic
1151611140 17:75176130-75176152 CAGGAAAGTCACTTGAACTCCGG - Intergenic
1151639695 17:75382128-75382150 CAGAAAAATCACTTGAACTCGGG + Intronic
1155567106 18:27147444-27147466 CAGAAAAGAAACCAGGAGTCGGG + Intronic
1155644047 18:28055499-28055521 AAGAAGAGTTATTTGGAGACTGG + Intronic
1156339654 18:36199983-36200005 CAGAAAAGTTACTCTGAGCTGGG - Exonic
1156539573 18:37896331-37896353 CTGAAAAGTTGCCTGGAGTTTGG + Intergenic
1157332554 18:46714316-46714338 AAGAAAAGGGAGTTGGAGTCGGG - Intronic
1157623390 18:49028935-49028957 CAGAAGGGTCACTTGAAGTCAGG - Intergenic
1157835095 18:50894202-50894224 CAGCAAAGTTACTTGCAAACTGG + Intronic
1161544773 19:4873734-4873756 CAGAAGAATTACTTGAAGCCAGG + Intergenic
1163126847 19:15248898-15248920 GAGAAAACATACTTGGGGTCTGG + Intronic
1163169878 19:15523714-15523736 CAAAAAAATTACTTGCACTCAGG - Exonic
1168478919 19:56700712-56700734 CAGGAAAATCACTTGAAGTCGGG - Intergenic
1168667154 19:58212729-58212751 CAGAAAAGTATCTTGGGTTCCGG - Exonic
925568929 2:5288266-5288288 CAGAAAACCTGCTTGGAGTGAGG - Intergenic
925838855 2:7971760-7971782 CAGAAAAGTTATCTGAAGTTAGG - Intergenic
926351668 2:12001012-12001034 CAGAAGAGACAATTGGAGTCAGG + Intergenic
926741835 2:16117753-16117775 AAAAAAAGTTACTTGGATGCTGG - Intergenic
928082634 2:28324476-28324498 TAGAAAAGTTACTTTGGGCCAGG + Intronic
928575199 2:32647675-32647697 CAAAAAAGTTCTTTGGAGCCAGG + Intronic
928720252 2:34112762-34112784 CATAGAAGTGACTTGGAGGCAGG + Intergenic
928724798 2:34160019-34160041 CAGAAATGTTACTTGTGGTTTGG + Intergenic
928959463 2:36908817-36908839 TACAAAAGTTAGTTGGAGGCTGG + Intronic
930077083 2:47415085-47415107 CAGAAGAATCACTTGAAGTCAGG - Intronic
930261987 2:49157683-49157705 AAGAAAAGGAAGTTGGAGTCAGG - Intergenic
930569578 2:53068050-53068072 CATTAAAGTTAATTGGAATCAGG - Intergenic
934853229 2:97714065-97714087 CAGAATATTAACTGGGAGTCAGG + Intronic
937035892 2:118781544-118781566 CAGAAAAGTTACTTGAACATAGG + Intergenic
937241423 2:120464932-120464954 CTGAACAGTGACTTGGTGTCAGG + Intergenic
937475406 2:122210539-122210561 CACAAAAGTTACCTGGAGAGTGG + Intergenic
939028709 2:137044860-137044882 CAGAATAGTGACATGGATTCAGG - Intronic
939499217 2:142961098-142961120 CAGAAGAGTCACTTGAACTCGGG + Intronic
939913656 2:148013946-148013968 AACAAAAGTTACTTGGTGTATGG - Intronic
940951201 2:159676326-159676348 CAGAAAAGATAATTGAAGCCAGG - Intergenic
941133943 2:161689929-161689951 CAGAAAAGTTTTGAGGAGTCTGG - Intronic
941822908 2:169860331-169860353 CAGATAAGTTACTTGGACTCAGG + Intronic
943378781 2:187117236-187117258 CAGGAAGCTTACTTGAAGTCAGG - Intergenic
943871164 2:193001732-193001754 CAAAAAAGTTATCTGTAGTCAGG - Intergenic
944737066 2:202576943-202576965 CAGAAAGATCACTTGAAGTCAGG + Intergenic
946951459 2:224879663-224879685 CAGGAAAGTTACTTGAACCCAGG + Intronic
946962599 2:225000750-225000772 CAGGAGAATCACTTGGAGTCAGG + Intronic
947215543 2:227746370-227746392 CAGAAAAGTGCCATGAAGTCTGG - Intergenic
947862864 2:233374732-233374754 CAGAAAAGTTGCTTGAACCCAGG - Intronic
947878275 2:233482269-233482291 CAGAAGAGTCACTTGAACTCGGG + Intronic
1169812058 20:9618497-9618519 CAGGAAAATTACTTGAACTCGGG - Intronic
1171441267 20:25165269-25165291 AAGAAAAGTTTCTTTGACTCTGG + Intergenic
1171838676 20:30182263-30182285 CAGTAAAAGTACTTTGAGTCTGG - Intergenic
1172710141 20:36915642-36915664 CAGAAAAATCACTTGAAGCCAGG + Intronic
1172863543 20:38077008-38077030 CAGAAGAATTGCTTGAAGTCAGG - Intronic
1174003796 20:47394343-47394365 CAGCCAGGTTACTTGAAGTCAGG - Intergenic
1174517145 20:51101351-51101373 CAAAAAAGTTACTCAGAGTGTGG + Intergenic
1174522636 20:51143580-51143602 GAGATAAGTTGCTTGGGGTCAGG - Intergenic
1174554476 20:51383936-51383958 CAGAAAAGAGACCTGGAGGCTGG + Intergenic
1174755184 20:53151341-53151363 GAGAAAACTTACTTTGACTCTGG + Intronic
1177416931 21:20806181-20806203 CAGAAAGGTGAAATGGAGTCAGG - Intergenic
1178242360 21:30917516-30917538 CAGAAAAGTTGCTGGGAAGCAGG + Intergenic
1178347463 21:31842755-31842777 CAGGAAAGTTGCTTGAAGCCAGG + Intergenic
1178734019 21:35132352-35132374 CAGAAAAATTGCTTGAAGCCAGG + Intronic
1183595954 22:38811799-38811821 CAGAGAATTTACTTGGCTTCTGG + Intergenic
949204550 3:1422207-1422229 TATAATAGTTACTTGGTGTCTGG + Intergenic
949560124 3:5193688-5193710 CAGAAGAATTACTTGAACTCAGG - Intronic
949608117 3:5676349-5676371 CAGAACAGTTGCTTGGAGCATGG - Intergenic
951303546 3:21028489-21028511 CAGCAAAGTGAGATGGAGTCTGG + Intergenic
951691409 3:25400248-25400270 CACAAAAGTTACCAGGAGTTTGG + Intronic
954565916 3:51599911-51599933 TAAAAAAGTTACTTGGGGCCAGG - Intronic
955403030 3:58607119-58607141 CAGAAAACTTACCAGGAGGCTGG - Intronic
956449460 3:69359040-69359062 CAGAAAAGATATGTAGAGTCTGG + Intronic
957270881 3:78028796-78028818 CAGAAATGTTACAAGGATTCAGG + Intergenic
957557125 3:81777094-81777116 CAGTTAAGTTACATGGAATCAGG - Intergenic
957712625 3:83882425-83882447 CAGAAAGGTGATTTAGAGTCAGG + Intergenic
960046951 3:113208391-113208413 CAAAACAGTTAGGTGGAGTCTGG - Intergenic
961150245 3:124631819-124631841 CAGAAAAGCTACTGGGAGCTGGG - Intronic
964273149 3:154980050-154980072 GAGAAAACTTACTGGGAGACTGG - Intergenic
964329912 3:155590822-155590844 GAGAAAGGTTATTTTGAGTCAGG - Intronic
965681136 3:171252886-171252908 CAGAAAATTTAAATGGAGTAGGG + Intronic
967660893 3:192108616-192108638 CAGGAAGGTAGCTTGGAGTCTGG - Intergenic
967891387 3:194366727-194366749 CAGAAACGGTACTTAGAGCCTGG + Intronic
967932423 3:194700054-194700076 CTGAGAAGTTACTTGGGCTCTGG - Intergenic
968177053 3:196559722-196559744 CAGAAAAGTTTCTTGGTTTGGGG - Intronic
968400979 4:297173-297195 CAGAAAAGTCACTTGAATCCGGG + Intronic
968777190 4:2549818-2549840 CAGAAAAATCACTTGAACTCAGG - Intronic
971314016 4:25552228-25552250 CAGAAAAATCACTTGAAGCCAGG + Intergenic
972567044 4:40278952-40278974 CAGGAAAATTGCTTGGACTCAGG + Intergenic
973655682 4:53044924-53044946 CAAAAAACTTGCTTTGAGTCTGG + Intronic
973691803 4:53442422-53442444 CAGAAAACAAACTGGGAGTCAGG - Intronic
974259838 4:59511861-59511883 CAGGAAAGTCACTTGAACTCGGG - Intergenic
975179251 4:71324716-71324738 CAAAAACGTTACATGGATTCAGG - Intronic
977725658 4:100294220-100294242 AACAAAAGTTACTTGTAGTTTGG - Intergenic
978393189 4:108249178-108249200 CAGATAAGTTACTTAGAAACAGG - Intergenic
978729889 4:112013354-112013376 CAGAAAAGATACATGGGGCCAGG + Intergenic
979020046 4:115485730-115485752 CAGAAAATTTCCTTGTATTCAGG - Intergenic
980328765 4:131383839-131383861 CAGAAAACTTCCATGGAATCTGG - Intergenic
980561694 4:134485697-134485719 AAAAAAAGTAACTTGGATTCAGG - Intergenic
983357081 4:166676506-166676528 GAGAAAAAGTACTTGGAGTAAGG + Intergenic
983389559 4:167112054-167112076 CTTAAAAGTTACTTCGAGGCTGG - Intronic
984334763 4:178376823-178376845 CAGAAAAATTACTTGAACTGGGG + Intergenic
985399371 4:189579336-189579358 CAGCAGAGTTATTTAGAGTCAGG + Intergenic
986494216 5:8326243-8326265 CAGAAAAATTTCTTGGACCCAGG - Intergenic
987877135 5:23692401-23692423 CAGAAAAGTTACTGAAAGTGTGG + Intergenic
988055972 5:26097244-26097266 CAGAAAAGTTTGCTGGAGTCTGG - Intergenic
988806334 5:34744159-34744181 CAGACAAGACACTTGGAGACAGG - Intronic
989076337 5:37567153-37567175 GATAAAAGATACCTGGAGTCTGG + Intronic
989084441 5:37660553-37660575 AAGAAATGTTACCAGGAGTCAGG - Intronic
990427581 5:55702484-55702506 CAGAAAGATTACTTGAGGTCAGG - Intronic
990707709 5:58548512-58548534 TATAAAACTTACTTGGAGTTTGG - Intronic
991314260 5:65282471-65282493 CAGAGAATTAACTGGGAGTCTGG - Intronic
991388750 5:66119537-66119559 CAGAAAAGTTATGTGAAGACTGG + Intergenic
991658167 5:68923853-68923875 TAGTAAAGTTAATAGGAGTCTGG + Intergenic
992541899 5:77774358-77774380 TAGAAAATTAACTAGGAGTCTGG + Intronic
993482233 5:88438174-88438196 CAGAAAGGTGACCTGGAGTTTGG - Intergenic
993581739 5:89670813-89670835 CCTAAAAGTTACTGGGTGTCTGG - Intergenic
994090933 5:95808984-95809006 CAGAAAAGTCGCCTGGAGACAGG + Intronic
996690215 5:126332456-126332478 CAGAAAAGTTAATTAAACTCAGG - Intergenic
997384751 5:133463871-133463893 CAGCAAAGTTAGGTGGAGGCTGG + Intronic
997606903 5:135181691-135181713 CAGAAAGGATACTTGTTGTCTGG + Intronic
998174285 5:139892125-139892147 TAGGAAAGTTCCTTGGGGTCAGG + Intronic
998265691 5:140665906-140665928 CAGAAGAATCACTTGGATTCGGG + Intronic
998778560 5:145630614-145630636 CCTAAAAGTTATTTGGACTCTGG - Intronic
999431160 5:151526644-151526666 CAGAAAAGATATTTTTAGTCAGG + Intronic
1000144011 5:158435403-158435425 CTCAAAAGTTCCTTGAAGTCAGG + Intergenic
1002885656 6:1291329-1291351 CAGAAAAGTGACCAGAAGTCAGG + Intergenic
1003886048 6:10522380-10522402 CAGAAAAGTAGCTTTGAGTTTGG - Intronic
1004029569 6:11853088-11853110 CAGCAAAGAGACTTGGAGTCAGG + Intergenic
1004916987 6:20341392-20341414 CAGCAAAGTAACCTGGGGTCAGG + Intergenic
1005270847 6:24161456-24161478 CAGAAGAATTACTTGAACTCAGG + Intergenic
1005318014 6:24622944-24622966 CAGAAAAATTACTTGAACCCAGG + Intronic
1008220410 6:48847267-48847289 GAGAAATGTTACTTTTAGTCTGG - Intergenic
1008742961 6:54632042-54632064 CAGAAAGGTAACTTTGGGTCAGG + Intergenic
1009956502 6:70461191-70461213 CAAAATAGTGACTTGGAATCAGG + Intronic
1010713340 6:79201220-79201242 CAGTAAAGATACTAAGAGTCAGG + Intergenic
1011560275 6:88607109-88607131 CAGAAAAGATACTTTTAATCAGG + Intergenic
1012946198 6:105468540-105468562 CAGAAAAGTTTCTTAGAGGGAGG - Intergenic
1015535240 6:134260577-134260599 CAGAAGAATTACTTGAACTCAGG + Intronic
1016004130 6:139071758-139071780 CAGAAAAGTTGCTTGAACCCAGG + Intergenic
1016409076 6:143763032-143763054 CAGAAAAGTTAATTTTAGTTTGG - Intronic
1020484307 7:8702836-8702858 CAGAAAAGTTTCATGGAGTCAGG - Intronic
1021924862 7:25524515-25524537 CTGAAAAGTAAGTTGGAATCTGG + Intergenic
1023644583 7:42296444-42296466 CAGAAAAATCACTTGAGGTCAGG - Intergenic
1024946660 7:54814699-54814721 GAGAAAAGTGAATTGGAGTCAGG + Intergenic
1026305877 7:69141359-69141381 CAGGAAAATTGCTTGGACTCAGG - Intergenic
1027489622 7:78806773-78806795 CAGAAAAATCACTTGAACTCAGG + Intronic
1030747957 7:113191165-113191187 CAGAAAAGATACTTGAAGCTGGG - Intergenic
1031418402 7:121520344-121520366 CTGAAAAGTCATGTGGAGTCAGG - Intergenic
1032416661 7:131740708-131740730 CAGAATAGTCACTAGGGGTCAGG + Intergenic
1034633688 7:152550630-152550652 CAGAAAAGAAACATGGGGTCTGG + Intergenic
1035792055 8:2315871-2315893 CATAAAAGTTACTTGGCGGAGGG + Intergenic
1035800750 8:2405834-2405856 CATAAAAGTTACTTGGCGGAGGG - Intergenic
1036732511 8:11278291-11278313 CAGACAAGTTGCTGGGAGTGAGG + Intergenic
1038703629 8:29874216-29874238 CAGGAAAGTTGCTTGAACTCGGG - Intergenic
1039320081 8:36419837-36419859 GAGGAGAGTCACTTGGAGTCAGG + Intergenic
1042322457 8:67491184-67491206 CAGAAGAATCAATTGGAGTCGGG + Intronic
1042346831 8:67736146-67736168 CAGGAAAGTGAGATGGAGTCAGG - Intronic
1042869065 8:73380898-73380920 CAGAAAAATCACTTGAAGCCAGG + Intergenic
1044714666 8:95089367-95089389 CAGAAATGTGACTTGGAGGCTGG - Intronic
1045605571 8:103769897-103769919 CACAAAAATTACTTTTAGTCAGG + Intronic
1047205802 8:122802356-122802378 AAGAAAAGTGACTTGAAGCCGGG - Intronic
1047805247 8:128352599-128352621 GAGAAATGTTTCCTGGAGTCAGG - Intergenic
1048045106 8:130765589-130765611 CAGAGAAGTTACTTTGTGCCAGG + Intergenic
1048973956 8:139661008-139661030 CAGGAAAGTTATTTTGAGTTGGG - Intronic
1052625323 9:30967947-30967969 CAGATAAGTTACGTGGAAACAGG - Intergenic
1055949034 9:81713770-81713792 AAAAAAAGTCACTTGGAGGCTGG - Intergenic
1056988793 9:91390335-91390357 CAGAAGAGTCACTTGAAGCCAGG - Intergenic
1058364929 9:104197948-104197970 CTGAAAAATAACTAGGAGTCAGG + Intergenic
1058933406 9:109745016-109745038 CTGAAAAGTTGCTTGGTGCCTGG - Intronic
1058978909 9:110151092-110151114 CAGAAAAGTTCCCTGGAAGCTGG + Intronic
1059114706 9:111590653-111590675 CAGAAAAATTACATGAAGGCTGG - Intronic
1185665901 X:1765386-1765408 CAGAAAAGTTGCCTGCAGTTTGG - Intergenic
1186128279 X:6439609-6439631 CTGAAAATTTACTTGGGGTTTGG - Intergenic
1186268648 X:7860181-7860203 TAGAAAAATTACTTAGAGACTGG - Intergenic
1186835726 X:13435939-13435961 CAGAAGAGATGCTTGGAATCCGG + Intergenic
1190183047 X:48209957-48209979 CAGGAAAATTGCTTGGACTCAGG - Intronic
1190192169 X:48286321-48286343 CAGGAAAATTGCTTGGACTCAGG + Intergenic
1194742908 X:97596526-97596548 TAGAAAAGTGAATTGGATTCAGG + Intronic
1195418161 X:104642575-104642597 CAGAAAAGTTGCTTGGACCTGGG - Intronic
1197083291 X:122443766-122443788 CAGAAGAGTTACTTAGGGGCAGG - Intergenic
1197573288 X:128176941-128176963 CAGAAGAGTTGCTTGAAGCCAGG + Intergenic
1198807612 X:140506052-140506074 AAGAAAAGTTTCTTGGAGGGGGG + Intergenic
1198811287 X:140538807-140538829 CAGGAAGATGACTTGGAGTCTGG + Intergenic
1200947490 Y:8860190-8860212 CAGGAAAATTGCTTGAAGTCGGG + Intergenic
1201259218 Y:12141545-12141567 AAGAAAAGATATTAGGAGTCTGG - Intergenic
1201610421 Y:15836964-15836986 CTGAAAATTTTCTTGGAGTTTGG - Intergenic