ID: 1110306310

View in Genome Browser
Species Human (GRCh38)
Location 13:73991348-73991370
Sequence TCTAACATGCACTTGGTGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 115}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110306310_1110306313 -5 Left 1110306310 13:73991348-73991370 CCATGCACCAAGTGCATGTTAGA 0: 1
1: 0
2: 0
3: 13
4: 115
Right 1110306313 13:73991366-73991388 TTAGAATTAATGACCTTTGAGGG 0: 1
1: 0
2: 0
3: 24
4: 251
1110306310_1110306312 -6 Left 1110306310 13:73991348-73991370 CCATGCACCAAGTGCATGTTAGA 0: 1
1: 0
2: 0
3: 13
4: 115
Right 1110306312 13:73991365-73991387 GTTAGAATTAATGACCTTTGAGG 0: 1
1: 0
2: 3
3: 14
4: 191

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110306310 Original CRISPR TCTAACATGCACTTGGTGCA TGG (reversed) Intronic
900863466 1:5250261-5250283 TCTCACATGCCCTTTGTGCTGGG + Intergenic
901754628 1:11434122-11434144 CCTAAGATGCACTGGGTGCTAGG - Intergenic
902254149 1:15176684-15176706 TTGACCATGCACTTTGTGCAGGG - Intronic
904275330 1:29380094-29380116 TTTTCCATGCACTTGGTGCTGGG + Intergenic
905745356 1:40412367-40412389 TTTAAAATGCACTTTATGCAGGG - Intronic
906886174 1:49651197-49651219 CCTATCATGCCCTTGTTGCAAGG - Intronic
907742127 1:57176850-57176872 TCTAATATGAACTTTGTCCATGG + Intronic
907925708 1:58953529-58953551 TCTTCCATGCACATGGTGCAAGG - Intergenic
910515179 1:88052940-88052962 TCTAGGATGCATTTGGAGCAGGG + Intergenic
910820370 1:91338664-91338686 GCTAGCATGCACATGGTGCACGG + Intronic
911249487 1:95558834-95558856 TCTACCATGGACTTGGACCAAGG - Intergenic
912533326 1:110341806-110341828 TCCAACATGCATCTGTTGCAGGG + Exonic
914831069 1:151171374-151171396 TCTTACATGCACCTGTTGCATGG - Intronic
917726466 1:177832412-177832434 TCTGACATGAAATTGGTACATGG - Intergenic
918926668 1:190795235-190795257 TCTAAAATGGTTTTGGTGCATGG - Intergenic
921130674 1:212216985-212217007 TCTAAAATGGACTGGGTGCATGG + Intergenic
922207872 1:223464414-223464436 TCTCACAGGTACTGGGTGCATGG + Intergenic
1067547384 10:47203598-47203620 ACTTACATGCTGTTGGTGCAAGG - Intergenic
1073563716 10:104518179-104518201 TTTATCCAGCACTTGGTGCACGG - Intergenic
1074789856 10:116876087-116876109 TCTATCACGCACTTGGTTCCAGG + Exonic
1080427205 11:32166881-32166903 TCTAAAATGAATTTGGGGCATGG + Intergenic
1085700849 11:78744768-78744790 GGTAACATACATTTGGTGCAAGG + Intronic
1085761509 11:79245205-79245227 TCAAACATGCAATGGCTGCAGGG - Intronic
1086571242 11:88286739-88286761 TATAACATTCATTTGGTGCTGGG + Intergenic
1090355008 11:126134388-126134410 TCTAACGGGCACTTGGTCCTTGG - Intergenic
1094006020 12:25752500-25752522 TGTAAAATGCACTTAGTACATGG - Intergenic
1097171415 12:57115997-57116019 TCTCCCATGTACTTGGTGCTGGG + Intronic
1101309713 12:103565120-103565142 CCTATCATGCCCTTGTTGCAGGG - Intergenic
1101732130 12:107435543-107435565 TGTCTCATGCAGTTGGTGCAGGG + Intronic
1104399357 12:128462987-128463009 TCTGCCATGCACTTGGTGTCTGG + Intronic
1110306310 13:73991348-73991370 TCTAACATGCACTTGGTGCATGG - Intronic
1121868807 14:97388299-97388321 TATAACATGCATTTGGTCCAAGG + Intergenic
1123935066 15:25190149-25190171 AGCAACGTGCACTTGGTGCATGG + Intergenic
1125133360 15:36311102-36311124 TGTAAAATGTACATGGTGCATGG - Intergenic
1127592773 15:60443529-60443551 TCTCACATGCACGTAGTTCAAGG - Intronic
1127659757 15:61089504-61089526 TCTTTCAGGAACTTGGTGCAAGG + Intronic
1127992399 15:64130331-64130353 TCTGAAATGCACTTGGAGCTAGG + Intronic
1128262255 15:66240717-66240739 TCTGCCATGCACTAGCTGCATGG - Intronic
1131588634 15:93723323-93723345 TCTAACATGCAATTTGAGAAAGG + Intergenic
1138918131 16:61493339-61493361 TTTAACATGTAATTGGTGCCTGG + Intergenic
1139659219 16:68409568-68409590 ACTCAGATGCACTTGGTGCATGG + Intronic
1141821824 16:86451336-86451358 TCCCACAGGGACTTGGTGCAGGG - Intergenic
1152300663 17:79493718-79493740 TATATCATGCACTTGGTTTATGG - Intronic
1156853364 18:41754334-41754356 TATAACATGTACTGTGTGCATGG - Intergenic
1160977890 19:1802702-1802724 TCTCACCTGCACCCGGTGCAGGG - Intronic
1162139020 19:8574375-8574397 CATAACATGCACTTGATCCATGG - Intronic
1163400727 19:17090928-17090950 TTTCACATCCACTTGGGGCAGGG + Intronic
1166278393 19:41772425-41772447 TGTAACATGCACATGTTCCAGGG + Intergenic
1166846882 19:45733787-45733809 TAGAACATGCTCTGGGTGCAGGG + Intronic
925405647 2:3604088-3604110 GCTGGCATGCACTTGGTGCCTGG + Intronic
925641193 2:5987124-5987146 CCTACCTTGCACTTGGTGCTGGG + Intergenic
928385562 2:30864884-30864906 GCTAACAAGCACTTGGACCATGG - Intergenic
934232675 2:90199588-90199610 TCTAACTGGCTCTTGGTTCAAGG - Intergenic
935429706 2:102962071-102962093 TCTAAGGTACACTTGGTGAACGG + Intergenic
945205152 2:207323595-207323617 TCAATCATGCAGTTTGTGCATGG - Intergenic
945843037 2:214910931-214910953 TCTCTCATGCAATTGGGGCAGGG - Intergenic
946794306 2:223333130-223333152 TATTACATCCACTTGGTGCAGGG - Intergenic
1169997192 20:11571675-11571697 TGTAACATTCTCTTGGTGAAAGG - Intergenic
1170458704 20:16556685-16556707 TGGAACATGCAATGGGTGCAGGG - Intronic
1174326756 20:49785345-49785367 CCTAACATGTACATGGTTCATGG - Intergenic
1174794505 20:53510905-53510927 TCCCACATGCACTAGGGGCAGGG + Intergenic
1176409327 21:6439425-6439447 CCTAACAGGCACTCTGTGCACGG + Intergenic
1176951694 21:15055080-15055102 ACCAACGTGCACTTGGTTCATGG + Intronic
1178412128 21:32373365-32373387 TCTAACAGGCAAGTGCTGCAGGG + Intronic
1178614060 21:34114955-34114977 CTTAGCAGGCACTTGGTGCAGGG + Intronic
1179381912 21:40907835-40907857 TCTAGCATGCATTAGCTGCATGG + Intergenic
1179684820 21:43047747-43047769 CCTAACAGGCACTCTGTGCACGG + Intergenic
1181433054 22:22894562-22894584 TCTAACATGCCCTTTGAGGAAGG - Intronic
1184240364 22:43208581-43208603 TCAGGCCTGCACTTGGTGCAAGG + Intronic
1185198280 22:49486258-49486280 TCTAACTAGCTCTTGGTGAAGGG + Intronic
952836197 3:37604389-37604411 TCTAAAATTCACTTGATGAATGG - Intronic
958438761 3:94130317-94130339 TCTGATATCCACTTTGTGCAGGG - Intergenic
960596260 3:119410755-119410777 TTTAACATGAACTTTGTGCCAGG + Intronic
965382469 3:168006923-168006945 TCTATCAAGCACTTTGTCCAAGG + Intergenic
967681543 3:192369718-192369740 TCCAACATGCACTAGGTGCTGGG + Intronic
970184142 4:13431291-13431313 TTTATCATGCCCTTGTTGCAGGG - Intronic
970567080 4:17341938-17341960 TCTCACATGGAATTGGTGGAGGG + Intergenic
974307756 4:60162694-60162716 TCTTCCATGCACTTGGTCAAAGG - Intergenic
974635244 4:64555708-64555730 TCTAACATGTTCTCTGTGCAAGG - Intergenic
975850476 4:78566764-78566786 TCTTACATGCAGATGGTGCATGG - Intronic
977605994 4:98985585-98985607 TTTAACATTCACTTGATCCAGGG + Intergenic
977614122 4:99068726-99068748 GCTTACATGCACTTAGTGAATGG + Intergenic
977734356 4:100394997-100395019 TCCAACATGCACTATGTGCCAGG - Intergenic
978989171 4:115056594-115056616 TCTATCATGCACTTGGTAGAGGG - Intronic
980217023 4:129865614-129865636 TGTAACATCCACTTTGTGGATGG - Intergenic
982476591 4:155859418-155859440 TCTGACATACACTTGGTATAGGG + Intronic
983549698 4:169004049-169004071 ACTAACCTGCACATTGTGCACGG + Intronic
986038238 5:3961318-3961340 TCTGAAATGAACTTGGTGCAGGG - Intergenic
993997889 5:94744357-94744379 TCTAAAATGCACAGGGAGCAAGG + Intronic
994235480 5:97357793-97357815 TCTAACCTGCATTTGCTTCAGGG + Intergenic
996779536 5:127170943-127170965 TCCAACATGCAGTTGTTGCAGGG - Intergenic
999250109 5:150177417-150177439 TCTAGCATGCAGGAGGTGCATGG - Intronic
1008235517 6:49042900-49042922 TCTAATATGCAATTATTGCAAGG - Intergenic
1010447210 6:75961705-75961727 TCTCACTTGCATTTGCTGCATGG - Intronic
1012023976 6:93964671-93964693 TTGAATATGCACTTGGTGAATGG - Intergenic
1012280524 6:97322494-97322516 TCAAACAAGAACTGGGTGCAAGG + Intergenic
1013111035 6:107065407-107065429 TCTGATATCCACTTTGTGCAGGG + Exonic
1014536770 6:122622869-122622891 TTAAACATGAACTTGGGGCAGGG + Intronic
1015154418 6:130075675-130075697 TCAAAAATGCTCATGGTGCAGGG - Intronic
1018817427 6:167343874-167343896 TGTAACATGCTCTTGATGAATGG - Intronic
1019764601 7:2841281-2841303 TCTAACACGCACTTCATACAGGG + Intronic
1020052226 7:5089247-5089269 TCTTGCATGCAGTTGGTGGAAGG - Intergenic
1020833326 7:13118369-13118391 TCTAACATGGCCATGGTTCATGG - Intergenic
1023749159 7:43353649-43353671 TTTTCCATGCACTTGGTGCCAGG - Intronic
1024552076 7:50570872-50570894 ACTAACCTGCACGTTGTGCATGG - Intergenic
1028829402 7:95311019-95311041 TCTTAGATGCACTTGATTCAGGG + Intronic
1029625116 7:101715938-101715960 TTGAACATGCACTTGGAGCCGGG + Intergenic
1034881460 7:154765901-154765923 TCTAAACTGCATTTGGTGCATGG + Intronic
1035445183 7:158936449-158936471 TTTTCCATGCACTTGGTGCCAGG - Intronic
1035996882 8:4557781-4557803 TCTAACCTGAACGTGGGGCACGG - Intronic
1037569162 8:20144067-20144089 TCTGACATCCACCTGGGGCAGGG - Intergenic
1037927762 8:22857922-22857944 ACTTACATGCCCCTGGTGCATGG + Intronic
1038251161 8:25906411-25906433 TCAAACAGGAACTTCGTGCATGG - Intronic
1042140417 8:65673298-65673320 TCTTACATGTGCTTGGTTCATGG + Intronic
1043000432 8:74753159-74753181 TCTAATGAGCATTTGGTGCATGG + Intronic
1045803849 8:106133743-106133765 TTTACCTTGGACTTGGTGCACGG + Intergenic
1046152889 8:110251840-110251862 GCTACTATGCACTTGGTGAAAGG + Intergenic
1047219441 8:122907852-122907874 CCTAACATGAACCTGGTGCTGGG - Intronic
1052760839 9:32589599-32589621 TTTAAAATCCACTTGGAGCAAGG - Intergenic
1055557292 9:77488257-77488279 TTTTCCATGCACTTGGTGCCGGG - Intronic
1057110709 9:92468087-92468109 TCTAACCCTCACTTGTTGCATGG - Intronic
1061590004 9:131592050-131592072 TCCAAAATGCCCATGGTGCAGGG + Intronic
1062622454 9:137429000-137429022 CCTCACCTGCACTTGGTCCAGGG - Exonic
1186183291 X:6993598-6993620 TCTGACATGCACTTCATACATGG + Intergenic
1187426754 X:19184357-19184379 TCTAAGATGCACTTGGTCTTGGG - Intergenic
1188924869 X:36027230-36027252 TCTTACATGCATATGTTGCATGG + Intergenic
1189430300 X:40940303-40940325 TCTAAAATGGCCTGGGTGCAGGG - Intergenic
1199089498 X:143674932-143674954 TATAACATGCGCAAGGTGCAGGG + Intergenic
1199424057 X:147681029-147681051 TCAAACATGCAATTGGTGAGTGG - Intergenic