ID: 1110306332

View in Genome Browser
Species Human (GRCh38)
Location 13:73991673-73991695
Sequence AAGTGGAATCAAAAAGAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1095
Summary {0: 1, 1: 0, 2: 4, 3: 247, 4: 843}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110306332 Original CRISPR AAGTGGAATCAAAAAGAGGC AGG (reversed) Intronic
900012145 1:123971-123993 GAGAGGAGTCGAAAAGAGGCTGG - Intergenic
900042205 1:479961-479983 GAGAGGAGTCGAAAAGAGGCTGG - Intergenic
900063645 1:714957-714979 GAGAGGAGTCGAAAAGAGGCTGG - Intergenic
900212155 1:1461482-1461504 AAGAGGAACGTAAAAGAGGCCGG - Intronic
900224857 1:1528257-1528279 AAGAGGAATGGAAAAGACGCCGG - Intronic
900700309 1:4044209-4044231 AAGAGGAAGAAGAAAGAGGCTGG - Intergenic
900722368 1:4185662-4185684 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
900776032 1:4586111-4586133 AAGGGAAATCAAAAATATGCTGG + Intergenic
900847659 1:5116411-5116433 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
902112700 1:14096242-14096264 AAGTGGATTCAGAGAGAGGCAGG + Intergenic
902750580 1:18506802-18506824 AAGTGGAATGAGGAAGAGGGAGG - Intergenic
903395841 1:23001369-23001391 AAGTAAAAGCAAAGAGAGGCGGG + Intergenic
904867696 1:33594492-33594514 AAGAGAAATAAAAAAGAGGCTGG - Intronic
904996309 1:34634377-34634399 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
905060350 1:35134752-35134774 AAGTGAAAGCAAAGAAAGGCTGG + Intergenic
905353132 1:37361168-37361190 ACGTGGAATCAATCAGAGGCAGG - Intergenic
905499957 1:38428359-38428381 AAGTGAAAGCAGAGAGAGGCTGG - Intergenic
905554339 1:38870495-38870517 AAGTAAAAACAAATAGAGGCCGG + Intronic
905706520 1:40063941-40063963 GAGTGGAACAAAAAAGAGACAGG + Intronic
906016611 1:42587425-42587447 GAGTGGAACCAAAAAGAAGTAGG + Intronic
906378877 1:45318839-45318861 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
906744343 1:48211402-48211424 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
906912426 1:49968732-49968754 AACTGGAAACCAAATGAGGCAGG - Intronic
907503399 1:54900288-54900310 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
907904687 1:58773558-58773580 AAGTGAAGTCAGAAAGAGGCAGG - Intergenic
908461535 1:64352387-64352409 AAGTGAAAGCGAAGAGAGGCTGG + Intergenic
908591775 1:65644298-65644320 AAGTGAAGGCAAAGAGAGGCTGG + Intergenic
908852585 1:68389554-68389576 AAGTGAAAGCAAAGAGTGGCTGG - Intergenic
908972650 1:69855950-69855972 AAATGGAAACAAAAAAAGGCAGG - Intronic
908976842 1:69909094-69909116 AAATGGAAACAAAAAAAGGCAGG - Intronic
908978518 1:69926632-69926654 AAATGGAAACAAAAAAAGGCAGG - Intronic
909014896 1:70370691-70370713 AAGTGAAAGCAAACAGAGGCTGG - Intronic
909035645 1:70591586-70591608 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
909040657 1:70645774-70645796 AAGTGGAAGAAAAGAGGGGCCGG + Intergenic
909222492 1:72982261-72982283 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
909474393 1:76065672-76065694 ATGTGGGACCAGAAAGAGGCGGG + Intergenic
909744636 1:79078655-79078677 AAGAGGAATTAAAAAGAAGGGGG - Intergenic
909910142 1:81248729-81248751 AAGTGAAAGCGAAGAGAGGCTGG - Intergenic
909978275 1:82069941-82069963 AAGTGAAAGCGAAGAGAGGCTGG + Intergenic
910002558 1:82357277-82357299 AAGTGAAAGCGAAGAGAGGCTGG + Intergenic
910049568 1:82958631-82958653 AAGTGAAAGCGAAGAGAGGCTGG - Intergenic
910111486 1:83688334-83688356 AATGGAAAACAAAAAGAGGCAGG - Intergenic
911147805 1:94569284-94569306 AAGTGAAAGCGAAGAGAGGCTGG + Intergenic
911562723 1:99426075-99426097 AAATGGAATTTAAAAGAGGAAGG - Intergenic
911570563 1:99512910-99512932 AAGTGAAAGCAAAGAGAGTCTGG - Intergenic
911851718 1:102828797-102828819 AATGGAAATCAAAAAAAGGCAGG + Intergenic
911984008 1:104599265-104599287 AAGTGAAAGCAAAGAGAGTCTGG - Intergenic
911985221 1:104614823-104614845 AAGTGGAATAGAAAAGAGTGTGG + Intergenic
912108814 1:106314702-106314724 AATGGAAAACAAAAAGAGGCAGG + Intergenic
912813744 1:112812721-112812743 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
912941779 1:114051423-114051445 AAGTGGAATCTCAAGGAGGTAGG + Intergenic
912953772 1:114138171-114138193 AAGTGGGGTCAAGAAGAGGAAGG - Intronic
913245304 1:116865392-116865414 AAGTGAAAGCGAAGAGAGGCTGG - Intergenic
913258537 1:116977040-116977062 AAATGGAAACAAAAAAAGGCAGG + Intronic
913581048 1:120227155-120227177 TAGAGGAATTATAAAGAGGCAGG - Intergenic
913627128 1:120671245-120671267 TAGAGGAATTATAAAGAGGCAGG + Intergenic
914562978 1:148838592-148838614 TAGAGGAATTATAAAGAGGCAGG - Intronic
914609849 1:149291630-149291652 TAGAGGAATTATAAAGAGGCAGG + Intergenic
914692265 1:150041166-150041188 AAATTGACTCAAAAAGAGGTGGG - Intergenic
915151725 1:153838498-153838520 AGGGGGAAAAAAAAAGAGGCAGG - Intronic
915863224 1:159470090-159470112 AAGTGGAAGCAAGGAGAGTCAGG - Intergenic
916006028 1:160661245-160661267 ACATGGAACCAAAAAGAGCCTGG - Intergenic
916152151 1:161804673-161804695 AAGTAGAAAAAAAAAAAGGCAGG - Intronic
917036411 1:170751874-170751896 CAGTGGGATAAAAAATAGGCTGG - Intergenic
917685016 1:177406939-177406961 AAGTAGAACCAAAAAGACACAGG - Intergenic
918153238 1:181817311-181817333 CAGTGGAATCAAAGTGTGGCAGG + Intergenic
918204002 1:182293050-182293072 AAGTGGCATTAAAAAAATGCAGG + Intergenic
918347295 1:183616938-183616960 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
918460308 1:184769730-184769752 AAGTGGAAAGAGAAAGAGGAAGG + Intergenic
918567491 1:185950719-185950741 AAGTGAAAGCGAAGAGAGGCTGG + Intronic
919476578 1:198038066-198038088 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
920425579 1:205872512-205872534 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
920829579 1:209452207-209452229 AAGTGAAAGCAAAGAGAGACTGG - Intergenic
921459598 1:215412365-215412387 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
921509435 1:216011287-216011309 AAGTGAAAGCAAAGAGAGGCTGG - Intronic
921552926 1:216560847-216560869 AAGAGAAATAAAAAAGAGTCAGG + Intronic
922048584 1:221969231-221969253 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
922049359 1:221975525-221975547 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
922153884 1:223026829-223026851 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
922363362 1:224842879-224842901 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
922514905 1:226200068-226200090 AAGAGGAAATAAAAAGAGGAAGG - Intergenic
922653820 1:227363705-227363727 AAGTGGAAAAAGAATGAGGCCGG + Intergenic
922727914 1:227933263-227933285 AGGTGGAAGCAAACAGAGGTTGG - Intronic
923143671 1:231182912-231182934 AAGTCAAAATAAAAAGAGGCAGG - Intronic
923214021 1:231832630-231832652 AAGTGAAAGCGAAGAGAGGCTGG + Intronic
923244928 1:232121469-232121491 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
923257163 1:232232055-232232077 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
923408448 1:233685855-233685877 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
923639837 1:235744601-235744623 AAGTGGAAAAAAAAAAATGCTGG + Intronic
923770565 1:236934686-236934708 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
923962957 1:239104652-239104674 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
924610711 1:245571426-245571448 AGATGGAATGACAAAGAGGCAGG - Intronic
924658870 1:245997962-245997984 CAGTGGGATCAGAAAGAGGTTGG - Intronic
1062930931 10:1352019-1352041 AAGTGAAAGCGAAGAGAGGCTGG - Intronic
1063363333 10:5474397-5474419 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
1063527504 10:6799519-6799541 AAGTGAAAGCGAAGAGAGGCTGG + Intergenic
1063562203 10:7139108-7139130 AATGGGAAACAAAAAAAGGCAGG + Intergenic
1064476220 10:15691633-15691655 ATGTGGAATCTAAAAAAGTCAGG + Intronic
1064886824 10:20121586-20121608 AAGTGAAAGCGAAGAGAGGCTGG + Intronic
1064990951 10:21256362-21256384 AAAGGGAAATAAAAAGAGGCTGG - Intergenic
1065427666 10:25621844-25621866 AAGGGAAAACAAAAAAAGGCAGG + Intergenic
1066297774 10:34069798-34069820 AACGGAAATCAAAAAAAGGCAGG + Intergenic
1066437039 10:35404925-35404947 AAGTGAAAGCGAAGAGAGGCTGG + Intronic
1067360581 10:45574492-45574514 AAGTGAAAGCGAAGAGAGGCTGG - Intronic
1068231147 10:54170042-54170064 AAGTGAAAGCGAAGAGAGGCTGG - Intronic
1068360948 10:55974485-55974507 AAGTGAAAGCACAGAGAGGCTGG - Intergenic
1070485454 10:76926285-76926307 AATTAGAAACAGAAAGAGGCAGG - Intronic
1071081986 10:81823549-81823571 AAATGGAATCATAAATAGGCCGG - Intergenic
1071373178 10:84974258-84974280 AAATGGAAACAAAAAAAAGCAGG + Intergenic
1071490923 10:86135744-86135766 AAGCGGAATCACAGAGAGGCTGG + Intronic
1071821912 10:89287993-89288015 AAGTGAAAGTGAAAAGAGGCTGG - Intronic
1071897564 10:90083462-90083484 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
1071916374 10:90298282-90298304 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
1071947951 10:90669157-90669179 TTGTGGAAACAAAAAGAGGAGGG + Intergenic
1071961291 10:90810712-90810734 AAGTGAAAGCGAAGAGAGGCTGG - Intronic
1072011152 10:91304164-91304186 AAGTGAAAGCGAAGAGAGGCTGG + Intergenic
1072746472 10:97942768-97942790 AAGTGAAAAAAAAAAAAGGCTGG + Intronic
1074019201 10:109565646-109565668 AAGTGAAAGCGAAGAGAGGCTGG - Intergenic
1074740958 10:116483937-116483959 AGGTGAAAGCAAAGAGAGGCTGG - Intergenic
1075014009 10:118896840-118896862 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
1075248877 10:120848129-120848151 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
1076037328 10:127210724-127210746 AAAGGAAAACAAAAAGAGGCAGG - Intronic
1077612368 11:3651226-3651248 AAGTGAAAGCAAAGAGAGGCTGG - Intronic
1077766210 11:5162706-5162728 AAGTGAAAGCGAAGAGAGGCTGG + Intronic
1077850624 11:6072258-6072280 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
1078045957 11:7914586-7914608 AAGTGAAAGCGAAGAGAGGCTGG + Intergenic
1079230691 11:18646331-18646353 AAGTGAAAGCGAAGAGAGGCTGG - Intergenic
1079447639 11:20571078-20571100 AAGTGAAAGCGAAGAGAGGCTGG - Intergenic
1079549122 11:21672872-21672894 AAATGAAAACAAAAAAAGGCAGG - Intergenic
1079672390 11:23186360-23186382 AAGTGAAAGCGAAGAGAGGCTGG + Intergenic
1079726909 11:23889612-23889634 AAGTGAAAGCGAAGAGAGGCTGG + Intergenic
1079847512 11:25489645-25489667 AAGTGAAAGCGAAGAGAGGCTGG + Intergenic
1080994310 11:37581133-37581155 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
1081356987 11:42123866-42123888 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
1082145023 11:48656564-48656586 AATGGAAAACAAAAAGAGGCAGG - Intergenic
1082197591 11:49323849-49323871 AAGTGAAAACAAAGAGAGGCTGG + Intergenic
1082599795 11:55135012-55135034 AATGGGAAACAAAAAAAGGCAGG + Intergenic
1082744430 11:56946686-56946708 AATGGAAAACAAAAAGAGGCAGG - Intergenic
1083089422 11:60184715-60184737 AAATGGAAAAAAAAAGAGGGGGG - Intergenic
1083350867 11:62027956-62027978 GATTGGAATCTAAAAGAGGCAGG + Intergenic
1083498672 11:63082562-63082584 AAGTGGATTTTAAGAGAGGCTGG + Intronic
1083508956 11:63189369-63189391 AAATGGAAACAAAAAAAAGCAGG - Intronic
1083534583 11:63456195-63456217 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
1084000557 11:66293323-66293345 AAGTGGAAACAACAAAAGGGGGG - Intronic
1084232473 11:67762953-67762975 AAGTGAAAGCGAAGAGAGGCTGG - Intergenic
1084354377 11:68627427-68627449 AGGTGAAAGCAAAGAGAGGCTGG - Intergenic
1084355727 11:68636992-68637014 AAGTGAAAGCGAAGAGAGGCTGG - Intergenic
1084613107 11:70216739-70216761 AAGTGAAAGCAAAGGGAGGCTGG + Intergenic
1085570367 11:77553159-77553181 AAGTGAAAGCGAAGAGAGGCTGG - Intronic
1085934449 11:81125076-81125098 AAGTGAAAGCGAAGAGAGGCTGG - Intergenic
1085988186 11:81809493-81809515 AAGTGAAAGCGAAGAGAGGCTGG - Intergenic
1086005195 11:82028511-82028533 AAGTGAAAGCGAAGAGAGGCTGG - Intergenic
1086101851 11:83108920-83108942 CAGTGAAATAAAAAACAGGCAGG - Intergenic
1086136095 11:83445326-83445348 AAGTGAAAGCGAAGAGAGGCTGG + Intergenic
1086273025 11:85090965-85090987 AAGAGGAAACAAAGAGAGACAGG + Intronic
1086550390 11:88046472-88046494 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
1086658235 11:89384278-89384300 AAGTGAAAACGAAGAGAGGCTGG - Intronic
1086758227 11:90592478-90592500 AAGCATAATCAAAAAAAGGCAGG + Intergenic
1087033062 11:93725440-93725462 AAGTGGAAGCAAAAAGACTCAGG - Intronic
1087099814 11:94352918-94352940 AAGTGAAAGCGAAGAGAGGCTGG - Intergenic
1087167902 11:95022921-95022943 AAGTGAAAGCGAAGAGAGGCTGG + Intergenic
1087389762 11:97517724-97517746 AAGTGAAAGCAAAAAGATACTGG + Intergenic
1087737503 11:101851491-101851513 AGGTGGAATGAACAAGAGGTGGG - Intronic
1087787592 11:102372991-102373013 AATGGAAAACAAAAAGAGGCAGG - Intronic
1087839366 11:102906506-102906528 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
1088555128 11:111053474-111053496 AAGTGAAAGCGAAGAGAGGCTGG - Intergenic
1088569585 11:111209583-111209605 AAGTGGAATTAAATAAATGCTGG - Intergenic
1088790802 11:113224478-113224500 AGGTGGAGTCTACAAGAGGCAGG - Intronic
1088891442 11:114047896-114047918 TAGAGGAAAGAAAAAGAGGCTGG + Intergenic
1089248409 11:117138851-117138873 AAGGGGAAAAAAAAAGAGGATGG - Intergenic
1089285234 11:117402992-117403014 AATGGAAAGCAAAAAGAGGCAGG - Intronic
1089810368 11:121126437-121126459 AAGTGTAATTCAAAAGAGCCAGG - Intronic
1089866877 11:121640350-121640372 AAGTGAAAGCGAAGAGAGGCTGG + Intergenic
1089953485 11:122550236-122550258 AGGTGAAAGCAAAGAGAGGCTGG - Intergenic
1089987846 11:122830402-122830424 AAGTGAAAGCGAAGAGAGGCTGG - Intergenic
1090107426 11:123868015-123868037 AAGTGAAAGCAGAGAGAGGCTGG + Intergenic
1090203106 11:124869748-124869770 AATTGGTATAAAAAAGGGGCGGG + Intronic
1090526636 11:127545155-127545177 AAGTGAAAGCGAAGAGAGGCTGG + Intergenic
1090871786 11:130755939-130755961 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
1091023607 11:132122925-132122947 AATTGGAAACAAAAAGAGCAAGG + Intronic
1091083905 11:132701464-132701486 AATGGGAATCAAAAGGAAGCAGG - Intronic
1091185491 11:133642978-133643000 AAGGGAAAACAAAAAAAGGCAGG + Intergenic
1091305697 11:134534803-134534825 AAGTGGGATGATAAAGAGGGTGG + Intergenic
1091886698 12:4021833-4021855 AAGTGAAAGCGAAGAGAGGCTGG - Intergenic
1092001945 12:5039953-5039975 CAGAGGAATAAAAAAGAAGCTGG + Intergenic
1092388890 12:8057776-8057798 AAGTGGAAGGAGAAAGAGGGTGG - Intergenic
1092474661 12:8808209-8808231 AAGTGAAAGCGAAGAGAGGCTGG - Intergenic
1092626576 12:10335350-10335372 AAGTGAAAGCGAAGAGAGGCTGG + Intergenic
1092924677 12:13262390-13262412 AGGTGAAAGCAAAGAGAGGCTGG + Intergenic
1093024519 12:14233861-14233883 ATGTGAAAGCAAAAAGAGGTTGG - Intergenic
1093070987 12:14707295-14707317 AAGTGAAAGCGAAGAGAGGCTGG + Intergenic
1093302474 12:17473236-17473258 AAGTGAAAGCGAAGAGAGGCTGG - Intergenic
1093358604 12:18198244-18198266 AGGTGAAAGCAAAGAGAGGCTGG - Intronic
1093578992 12:20766655-20766677 AAGTGAAAGCGAAGAGAGGCTGG - Intergenic
1093951248 12:25166433-25166455 AAGTGAAAGCGAAGAGAGGCTGG - Intronic
1094259774 12:28480054-28480076 AAGTGGAAAGAAAGAAAGGCTGG - Intronic
1094387641 12:29912204-29912226 AATGGAAAACAAAAAGAGGCAGG + Intergenic
1094469027 12:30785580-30785602 AAGGAGAAAAAAAAAGAGGCTGG + Intergenic
1095410688 12:41918229-41918251 AATAGGAAACAAAGAGAGGCGGG + Intergenic
1095534565 12:43229905-43229927 AAGGGAAAACAAAAAAAGGCAGG + Intergenic
1095637823 12:44453083-44453105 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
1095778362 12:46033430-46033452 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
1095817204 12:46437312-46437334 GAGTGGAGTAAAAAAGTGGCTGG + Intergenic
1095855045 12:46850865-46850887 AATGGGAAACAAAAAAAGGCAGG + Intergenic
1096359865 12:50974807-50974829 AATGGAAAACAAAAAGAGGCAGG + Intergenic
1097416879 12:59325642-59325664 AAGTGAAAGCGAAGAGAGGCTGG + Intergenic
1097542016 12:60954410-60954432 AAGTGAAAGCGAAGAGAGGCTGG + Intergenic
1097543998 12:60975868-60975890 AATGGAAATCAAAAAAAGGCAGG - Intergenic
1098173462 12:67769070-67769092 AAGTGAAAGCGAAGAGAGGCTGG + Intergenic
1098284463 12:68893697-68893719 AAATGGAATGAGAAATAGGCAGG + Intronic
1098629235 12:72706640-72706662 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
1098629853 12:72711320-72711342 AAGTGAAAGCGAAGAGAGGCTGG + Intergenic
1099106991 12:78508738-78508760 AAATGGAAACAAAAAAAGGCAGG + Intergenic
1099188896 12:79543151-79543173 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
1099291924 12:80785505-80785527 AAGTGAAAGCGAAGAGAGGCTGG + Intergenic
1099517224 12:83611708-83611730 AAGAGCAATAAAAAAAAGGCTGG + Intergenic
1099762761 12:86942089-86942111 AAGTGAAAGCGAAGAGAGGCTGG - Intergenic
1099835924 12:87909817-87909839 AAGTGAAAGCGAAGAGAGGCTGG + Intergenic
1099872969 12:88370965-88370987 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
1100561535 12:95752450-95752472 AAGTGAAAGCAAAGAGAGGCTGG - Intronic
1100992205 12:100263808-100263830 AAGTGGAAATAAAAAGAAGGAGG - Exonic
1101038014 12:100724224-100724246 AAGTGGAATCAAAGGGACGCCGG + Intronic
1101278221 12:103225099-103225121 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
1101855884 12:108442346-108442368 ATGTGGAATCTAACAGTGGCAGG + Intergenic
1103854063 12:123952777-123952799 AAGTGGAAGCAAAAAGTAGAAGG + Intronic
1103973847 12:124689178-124689200 AAGAGGAATCACAGAGAGGTGGG + Intergenic
1104263291 12:127205236-127205258 AATTGTACTCAAAAAGAGGCAGG - Intergenic
1106943621 13:34801924-34801946 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
1107018586 13:35729126-35729148 CTGTGGAATCAGAAAGATGCAGG + Intergenic
1108281879 13:48869540-48869562 AAGTGAAAGCGAAGAGAGGCTGG + Intergenic
1108513171 13:51173154-51173176 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
1108520464 13:51242708-51242730 AAGTGGAAAAAAAAACCGGCAGG + Intronic
1108588462 13:51891719-51891741 AAATGGAAGGAAAAAGAGGCAGG + Intergenic
1108913242 13:55580666-55580688 AAATGAAAGCAAAGAGAGGCTGG + Intergenic
1108919373 13:55657396-55657418 AAGTGAAAGCAAAGAGAGGATGG + Intergenic
1108947611 13:56043594-56043616 AAGTGAAAGCGAAGAGAGGCTGG - Intergenic
1108952777 13:56114843-56114865 AAGTGAAAGCGAAGAGAGGCTGG + Intergenic
1109343752 13:61091646-61091668 AGGTGAAAGCAAAGAGAGGCTGG - Intergenic
1109353089 13:61208090-61208112 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
1109499472 13:63216401-63216423 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
1109716564 13:66228806-66228828 AAGTGAAAGCAGAGAGAGGCTGG + Intergenic
1110306332 13:73991673-73991695 AAGTGGAATCAAAAAGAGGCAGG - Intronic
1110353491 13:74538544-74538566 AATGGGAAACAAAAAAAGGCAGG + Intergenic
1110969959 13:81749352-81749374 AATTGAAAACAAAAAAAGGCAGG + Intergenic
1110978659 13:81869467-81869489 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
1111125863 13:83910705-83910727 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
1111302221 13:86361699-86361721 AAGTGAAAGCGAAGAGAGGCTGG - Intergenic
1111361932 13:87188844-87188866 AAGTGAAAGCGAAGAGAGGCTGG + Intergenic
1111458666 13:88515254-88515276 AAGTGAAAGCGAAGAGAGGCTGG + Intergenic
1111564751 13:90000116-90000138 AAGTGGAAGCAATAAAAGGCAGG + Intergenic
1111630615 13:90842729-90842751 AAGTGAAAGCGAAGAGAGGCTGG - Intergenic
1112237002 13:97645602-97645624 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
1112249177 13:97763363-97763385 AAGTGGAATAAAAAATATGTGGG - Intergenic
1113356148 13:109582244-109582266 AAATGGAATCAACAAGAATCAGG - Intergenic
1113459617 13:110472851-110472873 GAGAAGAGTCAAAAAGAGGCTGG - Intronic
1114807545 14:25855740-25855762 AATGGGAAACAAAAAAAGGCAGG - Intergenic
1115240433 14:31247823-31247845 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
1115301325 14:31888640-31888662 AAGGGGGATTAAAAAGAGGAAGG - Intergenic
1115495087 14:33995807-33995829 AAATGGACTCAAAAAGACCCAGG + Intronic
1115558571 14:34562266-34562288 AGGTGGAATCGGACAGAGGCAGG - Intronic
1115605129 14:34993602-34993624 GAGAGGAATCATAAAAAGGCAGG - Intronic
1116179852 14:41519234-41519256 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
1116490404 14:45497806-45497828 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
1116501024 14:45622142-45622164 AAGTGGACTTAAAAAGAGAAGGG - Intergenic
1116534603 14:46014847-46014869 AAGTGAAAGCAAAGGGAGGCTGG + Intergenic
1116702228 14:48257807-48257829 AGGTGAAAGCAAAGAGAGGCTGG + Intergenic
1116703119 14:48264789-48264811 AAGTGAAAGCGAAGAGAGGCTGG + Intergenic
1116907992 14:50424412-50424434 AAGACGAATTAAAAATAGGCCGG + Intronic
1117174320 14:53131578-53131600 AAGTGAAAGCAAAAAAAGGCTGG - Intronic
1117801361 14:59447366-59447388 AAGTGAAAGCGAAGAGAGGCTGG - Intronic
1117953189 14:61103010-61103032 CAGTGGAGTAAACAAGAGGCAGG - Intergenic
1118693940 14:68365235-68365257 AAGTAGAATAAAGAGGAGGCAGG + Intronic
1118937079 14:70298223-70298245 AGGTGAAAGCAAAGAGAGGCTGG + Intergenic
1119022593 14:71127598-71127620 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
1119317375 14:73706773-73706795 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
1119321397 14:73733218-73733240 AAGGTGAATCAGAAATAGGCTGG + Intronic
1119560094 14:75583088-75583110 AAGTGAAAGCGAAGAGAGGCTGG + Intronic
1119966848 14:78926081-78926103 ATTTGGAGTCAAAAAGAGGTAGG - Intronic
1120251219 14:82063508-82063530 AAGTGAAAGCGAAGAGAGGCTGG + Intergenic
1120610556 14:86636344-86636366 AAATCAAATCAAAAAGAGCCAGG + Intergenic
1120618415 14:86734607-86734629 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
1120659783 14:87237462-87237484 AGGTGAAAGCAAAGAGAGGCTGG + Intergenic
1120709550 14:87779277-87779299 AATGGAAAACAAAAAGAGGCAGG - Intergenic
1121077035 14:91077455-91077477 AAGAAAAAACAAAAAGAGGCTGG + Intronic
1122360624 14:101159807-101159829 AAGTGTAATCAAAAAATTGCTGG - Intergenic
1122507808 14:102242909-102242931 AAGTGAAAGCAAAGAGTGGCTGG - Intronic
1122721179 14:103723495-103723517 AAAGGGAAACAAAAAAAGGCTGG + Intronic
1123822586 15:24045492-24045514 AATGGAAAACAAAAAGAGGCAGG + Intergenic
1123882318 15:24688004-24688026 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
1124597026 15:31099910-31099932 AAGTGCACTCATAGAGAGGCAGG + Intronic
1124807085 15:32895338-32895360 AAAGGGAAACAAAAAGAGGAAGG + Intronic
1125045948 15:35242061-35242083 AAGTGAAAGCGAAGAGAGGCTGG - Intronic
1125131339 15:36288062-36288084 AAGTGAAAGCGAAGAGAGGCTGG + Intergenic
1125213040 15:37238637-37238659 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
1125254819 15:37751411-37751433 AAGAGGAAGGAAAAAGAGGAAGG + Intergenic
1125629398 15:41134790-41134812 AAGTGAAAGCGAAGAGAGGCTGG - Intergenic
1126035636 15:44543232-44543254 AAGTGTCAGCAAAAAGAGACTGG - Intronic
1126529978 15:49701562-49701584 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
1126585273 15:50280012-50280034 AAGTGGAATCACAGAAAGGCAGG - Intronic
1126761511 15:51973946-51973968 AAGTGTAACCAAAACAAGGCTGG - Intronic
1126843923 15:52741868-52741890 AGGTGAAAGCAAAGAGAGGCTGG - Intergenic
1126912237 15:53429262-53429284 AAGTGAAGACAAAGAGAGGCTGG + Intergenic
1129785450 15:78307000-78307022 AACTGGAAACAAAAAGCGCCTGG - Intergenic
1130314399 15:82782639-82782661 CAGTGGAATCAAATGGATGCTGG + Intronic
1130365887 15:83238436-83238458 AAATGAAAACCAAAAGAGGCCGG + Intergenic
1130855281 15:87834556-87834578 AAGTGAAAGCGAAGAGAGGCTGG - Intergenic
1130945774 15:88549923-88549945 AAGTGAAAGCGAAGAGAGGCTGG + Intergenic
1131165046 15:90136123-90136145 AAGTGAAAGCGAAGAGAGGCTGG - Intergenic
1131339452 15:91583327-91583349 AAATGGAAACAAAAAAAGGCAGG - Intergenic
1131349754 15:91688403-91688425 AAGTGGAATCAAACAGTGTGTGG - Intergenic
1131447919 15:92514797-92514819 AAGTGAAAGCGAAGAGAGGCTGG - Intergenic
1131684353 15:94754060-94754082 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
1131684879 15:94757759-94757781 AAGTGAAATCAAAGAGAGGGTGG - Intergenic
1131882336 15:96874245-96874267 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
1132263189 15:100443578-100443600 AAGTGAAAGTGAAAAGAGGCTGG - Intronic
1133766580 16:8842514-8842536 AGGTGAAAGCAAAGAGAGGCTGG + Intronic
1133903981 16:10004037-10004059 AAAGGGAATCAAAAGGGGGCTGG + Intronic
1133938349 16:10286445-10286467 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
1134209313 16:12262478-12262500 AATTGGGATCAATAAAAGGCTGG + Intronic
1134342003 16:13354989-13355011 AAGTGAAAGCGAAGAGAGGCTGG + Intergenic
1134587127 16:15421314-15421336 CAGTGGAATCAAAGACAGGATGG - Intronic
1136158466 16:28401717-28401739 AGGAGGAGTCAAAAAGAGGATGG - Intronic
1136204621 16:28713566-28713588 AGGAGGAGTCAAAAAGAGGATGG + Intronic
1136530106 16:30862338-30862360 AAGTGAAAGCGAAGAGAGGCTGG - Intronic
1137018390 16:35397988-35398010 ATGTGGAATCAGAATGAAGCAGG - Intergenic
1138758918 16:59520060-59520082 AAGTGAAAGCGAAGAGAGGCTGG + Intergenic
1138805127 16:60082119-60082141 AAGTGAAAGCGAAGAGAGGCTGG - Intergenic
1139039063 16:62981568-62981590 AAGTGAAGGCAAAGAGAGGCTGG + Intergenic
1139230411 16:65277675-65277697 AAGTGAAGGCAAAGAGAGGCTGG + Intergenic
1139505789 16:67397517-67397539 AACTGGACACAAACAGAGGCTGG - Intronic
1139943551 16:70623216-70623238 AAGTGAAAGCGAAGAGAGGCTGG + Intronic
1140880448 16:79193414-79193436 AACTTGAATCAAAAAGCGGCTGG + Intronic
1141271905 16:82548927-82548949 AACTGGAGACAAACAGAGGCAGG - Intergenic
1141793912 16:86256639-86256661 AAGTGGTATGAAAATGAGGAAGG - Intergenic
1141796715 16:86279825-86279847 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
1141865026 16:86744455-86744477 AAGTGAAAGCGAAGAGAGGCTGG + Intergenic
1142452200 16:90182943-90182965 GAGAGGAGTCGAAAAGAGGCTGG + Intergenic
1142570454 17:870214-870236 AACTGGAATCAGAAAGTGACTGG - Intronic
1142991956 17:3737359-3737381 AAATGAAACGAAAAAGAGGCAGG + Intronic
1143414175 17:6734057-6734079 AAGTGAAAGCGAAGAGAGGCTGG + Intergenic
1144104843 17:11975176-11975198 AAGTGAAAGCGAAGAGAGGCTGG - Intergenic
1144158358 17:12531078-12531100 AAATAGAATCTGAAAGAGGCAGG - Intergenic
1144633398 17:16887783-16887805 AAGTGGGATCAAATACAGGGTGG + Intergenic
1144721232 17:17471238-17471260 AACTGGAATGCCAAAGAGGCTGG - Intergenic
1146412628 17:32600599-32600621 AAGTGGAAGCTAACAGAGGTTGG - Intronic
1146598079 17:34186566-34186588 AAGTGAAGGCAAAGAGAGGCTGG - Intergenic
1148006402 17:44434304-44434326 AAGGGGAAAGAAAAAGGGGCAGG + Intronic
1151116989 17:71747546-71747568 AATTGGAATGAAAAAGAGAAAGG + Intergenic
1151140465 17:71986602-71986624 GTCTGGAAACAAAAAGAGGCGGG + Intergenic
1151622662 17:75255859-75255881 AAGTGAAAGCAAAGAGAGGCTGG - Intronic
1151839572 17:76608379-76608401 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
1153114548 18:1639448-1639470 AGGTGGTAACAAAAAGAGGGAGG + Intergenic
1153231885 18:2945873-2945895 ATGTGGACTAAAAAAGATGCTGG - Intronic
1154271626 18:12925471-12925493 AATTAGAATTAAAAAGAGACAGG + Intronic
1154391882 18:13944435-13944457 CAGTGGAATGAAAAACAAGCAGG - Intergenic
1155174000 18:23287338-23287360 AAGTGAAAGCGAAGAGAGGCTGG - Intronic
1155659108 18:28227053-28227075 AAGTGGAAAGAAAAAAAAGCAGG - Intergenic
1155696845 18:28695536-28695558 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
1156207041 18:34897085-34897107 AATGGAAATCAAAAAAAGGCAGG + Intergenic
1156237536 18:35219054-35219076 AAGTGAAAGCGAAGAGAGGCTGG - Intergenic
1156616882 18:38797356-38797378 ATGTTGGATCAAAAAGAGGTGGG - Intergenic
1156938709 18:42739937-42739959 AAGTGAAAGCGAAGAGAGGCTGG - Intergenic
1156958358 18:42994165-42994187 AAGTGAAAGCGAAGAGAGGCTGG - Intronic
1157135803 18:45054089-45054111 AAGTTGAATGAAACAGAGGACGG + Intronic
1157690450 18:49677628-49677650 AAATGGAAGCACAGAGAGGCTGG - Intergenic
1157906216 18:51572457-51572479 AAGTGAAAGCGAAGAGAGGCTGG + Intergenic
1157963715 18:52184525-52184547 AAGTGGAAGAAAAATGATGCAGG - Intergenic
1158336548 18:56418882-56418904 AAGTGAAAGCGAAGAGAGGCTGG - Intergenic
1159164650 18:64684916-64684938 AAGTGAAAGCAGAGAGAGGCTGG - Intergenic
1159330379 18:66986643-66986665 AAGAAGAATCAAAAAAATGCTGG - Intergenic
1159929361 18:74295593-74295615 AAGTGAAAGCGAAGAGAGGCTGG - Intergenic
1160645285 19:186102-186124 GAGAGGAGTCGAAAAGAGGCTGG - Intergenic
1161661907 19:5551762-5551784 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
1161712293 19:5855707-5855729 AGGTAAAAGCAAAAAGAGGCTGG - Intergenic
1162274025 19:9638977-9638999 ATGTGAAAGCAAAAAGAGGTCGG + Intronic
1163761729 19:19140682-19140704 ACGAGGAAAAAAAAAGAGGCTGG + Intergenic
1163857805 19:19719082-19719104 AAGTGAAAGCAAGAAGAGACTGG + Intronic
1163900038 19:20093042-20093064 AGGTGAAAGCAAAGAGAGGCTGG + Intronic
1163907356 19:20158825-20158847 AAGTGAAAGCGAAGAGAGGCTGG - Intergenic
1164153153 19:22571532-22571554 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
1164219340 19:23179274-23179296 AAGTGAAAGTGAAAAGAGGCTGG - Intergenic
1164258935 19:23552536-23552558 AAGAGAAAGCAAAAAGAGGCTGG - Intronic
1164459064 19:28432359-28432381 AAGTGAAAGCGAAGAGAGGCTGG + Intergenic
1164816203 19:31205349-31205371 TAATGGAATAAAAAAGGGGCAGG - Intergenic
1164926904 19:32137800-32137822 AAGTGCTATTTAAAAGAGGCAGG - Intergenic
1165249420 19:34517282-34517304 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
1165493483 19:36139222-36139244 AAATTAAATCAAAAAAAGGCCGG + Intergenic
1165835535 19:38752898-38752920 AAGTGAAAGCAAAGAGAGGCTGG - Intronic
1166026381 19:40089740-40089762 AATTGGTATCAACAAGAGCCAGG - Intronic
1166103519 19:40585834-40585856 AAGTGAAATAAGAAAGAGGCCGG - Intronic
1166498761 19:43325929-43325951 AAGTGAAAGCAAAGAGAGGCGGG + Intergenic
1166926961 19:46275754-46275776 AAGTGAAAGCGAAGAGAGGCTGG + Intergenic
1167046438 19:47052241-47052263 AAGTGAAAGCGAAGAGAGGCTGG + Intergenic
1167099639 19:47396330-47396352 AAGTGAAAGCGAAGAGAGGCTGG - Intergenic
1167902324 19:52631060-52631082 AAGTGAAAGCGAAGAGAGGCTGG - Intronic
1168051811 19:53834890-53834912 AAGTGAAAGCGAAGAGAGGCTGG - Intergenic
1168211952 19:54897320-54897342 AAGTGAAAGCGAAGAGAGGCTGG + Intergenic
1168227809 19:55009222-55009244 AAGTGAAAGCGAAGAGAGGCTGG + Intergenic
925433679 2:3818316-3818338 AAGTGAAAGCGAAGAGAGGCTGG + Intronic
925795102 2:7532789-7532811 AAATGGAATTAGAAAGAGACAGG + Intergenic
925828645 2:7875097-7875119 AGGTGAAAGCAAAGAGAGGCTGG + Intergenic
926407938 2:12573044-12573066 AAGTGAAAGCGAAGAGAGGCTGG - Intergenic
926413767 2:12629790-12629812 AAGTGAAAGCGAAGAGAGGCTGG - Intergenic
926437142 2:12849701-12849723 AAGTGACATGAAGAAGAGGCAGG + Intergenic
926463772 2:13165348-13165370 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
926535138 2:14101453-14101475 AAATGAAAACAAAAAAAGGCAGG + Intergenic
926815370 2:16794359-16794381 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
927134334 2:20085600-20085622 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
928744373 2:34394396-34394418 AAGTGGAATAAAAATGGGGGAGG + Intergenic
928770640 2:34699514-34699536 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
928779538 2:34803387-34803409 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
928855408 2:35797027-35797049 AAGGGGAAACTAAAAGAGGAGGG + Intergenic
928928743 2:36602324-36602346 AAGTGAAGGCAAAGAGAGGCTGG - Intronic
929076501 2:38083188-38083210 AAGTGAAAGCAAAGAGAGGCTGG + Intronic
929467986 2:42163121-42163143 AAGTGGAAAGAAAAAAATGCAGG - Intergenic
929589774 2:43137390-43137412 TAGTGGGAGCAAGAAGAGGCAGG - Intergenic
929792888 2:45036858-45036880 AAGTGAAAGCAAAGAGAGACTGG + Intergenic
929868832 2:45740772-45740794 AGGTAGAATCAGAATGAGGCAGG - Intronic
930093444 2:47548421-47548443 AAGTGGAATCAAGGAGGGGCTGG - Intronic
930678187 2:54227320-54227342 AAGTGGAATAAAAGAGATGAGGG - Intronic
930955271 2:57196247-57196269 AAGCGAAAGCAAAGAGAGGCTGG - Intergenic
930958571 2:57232176-57232198 AAGTGAAAACGAAGAGAGGCTGG - Intergenic
931026219 2:58115843-58115865 AAGTGAAGGCAAAGAGAGGCTGG + Intronic
931042787 2:58316991-58317013 AAGTGAAAGCGAAGAGAGGCTGG - Intergenic
931237111 2:60420890-60420912 AAGTGAAGGCAAAGAGAGGCTGG - Intergenic
931417671 2:62097005-62097027 AAGTGAAAGCAAAAAGATACTGG + Intronic
931625955 2:64255820-64255842 AAGTGAAAGCGAAGAGAGGCTGG - Intergenic
931819444 2:65936628-65936650 AGGTGGAATCAAAGTGTGGCTGG - Intergenic
932220717 2:69997023-69997045 AAGTGGACACACAAGGAGGCTGG + Intergenic
932296019 2:70623919-70623941 AAATGAAAGCAAAGAGAGGCTGG - Intronic
932358644 2:71087465-71087487 AAGTGAAGGCAAAGAGAGGCTGG + Intergenic
932367069 2:71160360-71160382 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
933013263 2:77091659-77091681 AAGTGAAAGCGAAGAGAGGCTGG - Intronic
933079441 2:77968392-77968414 AAGTGAAAGCGAAGAGAGGCTGG - Intergenic
933138113 2:78761195-78761217 AAGTGAAAGCAAAGAGAGGATGG - Intergenic
933179600 2:79214269-79214291 AAGTGAAAGCGAAGAGAGGCTGG + Intronic
933343878 2:81058380-81058402 AAGTGGAAACAAAAAGAGCAGGG - Intergenic
933506535 2:83182927-83182949 CAATGGAATAAAAAAGAGACTGG + Intergenic
933552221 2:83791328-83791350 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
934765214 2:96876718-96876740 AAGAGGAGTCAAGAAGAGGCAGG + Intronic
935379359 2:102435306-102435328 AAGTGGAAACAGAAAGAAGGTGG + Intronic
935767205 2:106380730-106380752 AAGTGGAAATAAATACAGGCTGG + Intergenic
935827667 2:106967904-106967926 AAGTAGAGTTAAAAAAAGGCAGG + Intergenic
935931987 2:108136922-108136944 AAGTGAAATGAGCAAGAGGCTGG + Intergenic
936794118 2:116186688-116186710 AAGTGAAAGCGAAGAGAGGCTGG + Intergenic
936883506 2:117282024-117282046 AAGTGAAAGCGAAGAGAGGCTGG - Intergenic
936942338 2:117898284-117898306 AAGGGAAAACAAAAAAAGGCAGG + Intergenic
937595223 2:123664138-123664160 AAGTGGAATAAATAAGTGGCAGG - Intergenic
939013976 2:136879783-136879805 AAATGGAAACAAAAAAAGTCAGG + Intronic
939082976 2:137685363-137685385 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
939307577 2:140429425-140429447 AAGTGAAAGCGAAGAGAGGCTGG - Intronic
939460565 2:142492265-142492287 AAGTGAAATTGAAGAGAGGCTGG + Intergenic
939550329 2:143607227-143607249 AAGACAACTCAAAAAGAGGCTGG + Intronic
939634368 2:144563261-144563283 AAATGGAATTAAGCAGAGGCTGG - Intergenic
939734631 2:145828701-145828723 AAATGGAATCTAAAAGAGAGGGG - Intergenic
939807248 2:146788932-146788954 AGGTGGAGTCTACAAGAGGCAGG - Intergenic
939943626 2:148382272-148382294 AATGGAAATCAAAAAAAGGCAGG + Intronic
939975008 2:148707165-148707187 AATGGAAAACAAAAAGAGGCAGG + Intronic
940107523 2:150115893-150115915 AAGTGAAAGCGAAGAGAGGCTGG - Intergenic
940217004 2:151312127-151312149 AAGTGAAAGCAAAAAGAGGCTGG - Intergenic
940530358 2:154870603-154870625 AAGTGAAAGCGAAGAGAGGCTGG - Intergenic
940579185 2:155555100-155555122 AAGTAGACCCAAAAAGAGGATGG + Intergenic
941196330 2:162456828-162456850 AAATGGAAGCAAAAAAAAGCAGG - Intronic
941340568 2:164299135-164299157 AAGTGAAAGCGAAGAGAGGCTGG - Intergenic
941353561 2:164462401-164462423 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
941456022 2:165712923-165712945 AGGTGAAAGCAAAGAGAGGCTGG + Intergenic
941579282 2:167274493-167274515 AAGTGAAGTCAAAACCAGGCAGG + Intergenic
941935721 2:170980063-170980085 AAGTGAAAGCGAAGAGAGGCTGG + Intergenic
942730117 2:179054182-179054204 AGGTGAAAGCAAAGAGAGGCTGG + Intergenic
942976854 2:182029036-182029058 AAGGGAAAACAAAAAAAGGCAGG - Intronic
943061740 2:183047176-183047198 AAGTGAAAGCGAAGAGAGGCTGG - Intergenic
943254734 2:185580002-185580024 ACCTGAAATGAAAAAGAGGCTGG - Intergenic
943412754 2:187562908-187562930 AAGTGAAAGCCAAGAGAGGCTGG + Intronic
943421405 2:187672910-187672932 AAGTGAAGGCAAAGAGAGGCTGG + Intergenic
943450309 2:188036495-188036517 AAGTGAAAGCGAAGAGAGGCTGG - Intergenic
943461020 2:188171626-188171648 AAGTGAAAGCGAAGAGAGGCTGG + Intergenic
943660196 2:190551938-190551960 AAGTGGAATCAAAATGGAGCTGG - Intergenic
943806813 2:192133702-192133724 AAGTGAAAGCGAAGAGAGGCTGG - Intronic
943835569 2:192510762-192510784 AAGCGAAAGCAAAGAGAGGCTGG - Intergenic
943865514 2:192921347-192921369 AAGTGAAAGCGAAGAGAGGCTGG - Intergenic
943951123 2:194133307-194133329 AAGTGAAAGCCAAGAGAGGCTGG + Intergenic
944038263 2:195324132-195324154 AAGTGCATGCAAAAAGAGGCTGG - Intergenic
944394316 2:199250218-199250240 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
944875947 2:203964339-203964361 AAGTGAAAGCGAAGAGAGGCTGG + Intergenic
945152926 2:206809282-206809304 AAGTGAAAGCGAAGAGAGGCTGG + Intergenic
945173628 2:207020535-207020557 AAGTGGAAGCAAAGAGAGGTTGG - Intergenic
945301313 2:208218658-208218680 AGGTGAAAGCAAAGAGAGGCTGG + Intergenic
945361810 2:208902515-208902537 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
945376278 2:209081360-209081382 AAGTGAAAGCGAAGAGAGGCTGG - Intergenic
945394469 2:209302494-209302516 AAGAGAAAGCAAAGAGAGGCTGG - Intergenic
945602968 2:211890723-211890745 AATGGGAAACAAAAAAAGGCAGG + Intronic
945858298 2:215092872-215092894 AAGTGAAAGCGAAGAGAGGCTGG - Intronic
945938499 2:215925664-215925686 AAGTGAAAGCGAAGAGAGGCTGG - Intergenic
946115496 2:217458427-217458449 AAGGAGAATAAGAAAGAGGCTGG - Intronic
946214859 2:218176437-218176459 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
946572769 2:221042733-221042755 GTGTGGAATCTAAACGAGGCAGG - Intergenic
946780870 2:223192258-223192280 AAGTGAAAGCAAAGAGAGGCTGG + Intronic
946886670 2:224228578-224228600 AAGTGAAAGCGAAGAGAGGCTGG - Intergenic
946893448 2:224299958-224299980 AAGTGAAAGCGAAGAGAGGCTGG - Intergenic
947245792 2:228046905-228046927 ATGTGGAATCATAATGAGGTTGG - Intronic
947500668 2:230668645-230668667 AAGTGGCATCAAGAAGAAGATGG + Intergenic
947848474 2:233264630-233264652 AAGGGGATTTAAAAGGAGGCTGG - Intronic
948151495 2:235748135-235748157 AAGTGGAATGAAAATGAGACAGG + Intronic
948390867 2:237610238-237610260 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
1168739469 20:175520-175542 AAGTGAAAGCGAAGAGAGGCTGG - Intergenic
1168839440 20:899811-899833 AAGTGAAACCGAAGAGAGGCTGG - Intronic
1169762986 20:9116896-9116918 AAGTTGAATAAAAAACATGCAGG - Intronic
1170165916 20:13360236-13360258 AAGTGAAAGCGAAGAGAGGCTGG - Intergenic
1170324502 20:15141540-15141562 ACTTGGAATCAGAGAGAGGCAGG - Intronic
1170325312 20:15150250-15150272 AAGTGAAAGCGAAGAGAGGCTGG + Intronic
1170520722 20:17182051-17182073 AATGGAAATCAAAAAGAAGCAGG + Intergenic
1170680264 20:18520024-18520046 AAGTGAAAGCAAAGAGAGGCTGG + Intronic
1170820528 20:19753580-19753602 AAGTGAAGGCAAAGAGAGGCTGG + Intergenic
1171960880 20:31493188-31493210 AAGTGGAATGAAAAATATCCAGG - Intergenic
1172593102 20:36131404-36131426 AAGAGAAATAAAAAACAGGCTGG - Intronic
1172932293 20:38595134-38595156 AGGTGAAAGCAAAGAGAGGCTGG + Intergenic
1173031969 20:39369644-39369666 AATGGGAAACAAAAAAAGGCAGG + Intergenic
1173102084 20:40096617-40096639 AAGTGAAAGCAAAAAGAGGCTGG - Intergenic
1173119045 20:40272338-40272360 AAGTGAAGGCAAAGAGAGGCTGG - Intergenic
1173740620 20:45398466-45398488 AAATGGAATCATAAAAATGCTGG - Intronic
1173763603 20:45586622-45586644 AAGTGAACGCAAAGAGAGGCTGG + Intergenic
1173781891 20:45762951-45762973 AAGTGAAAGCAAAGAGAGGCTGG - Intronic
1174519807 20:51120713-51120735 AAGGGGATTCAAAACCAGGCTGG + Intergenic
1175197467 20:57254317-57254339 AAGAAGAAACCAAAAGAGGCTGG - Intronic
1176280227 20:64300119-64300141 GAGAGGAGTCGAAAAGAGGCTGG + Intergenic
1176907146 21:14515240-14515262 AAGTGGATTGAAAAAGAGAATGG + Intronic
1177030999 21:15982216-15982238 AAGTGAAAGCGAAGAGAGGCTGG + Intergenic
1177062902 21:16396147-16396169 AAGTGAAAGCGAAGAGAGGCTGG + Intergenic
1177100796 21:16895451-16895473 AGGTGAAAGCAAAGAGAGGCTGG - Intergenic
1177102847 21:16917279-16917301 AGGTGAAAGCAAAGAGAGGCTGG - Intergenic
1177402243 21:20620862-20620884 AAGTGGGAAAAAAAAGAGACCGG + Intergenic
1177587707 21:23119758-23119780 AAGTGGAAGCAAAAAGGTGAAGG - Intergenic
1177840578 21:26230471-26230493 AAGTGAAAGCGAAGAGAGGCTGG + Intergenic
1178001366 21:28164492-28164514 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
1178378505 21:32089085-32089107 AAATGGTATCAGAAAGAGACAGG + Intergenic
1178413787 21:32387443-32387465 GAGTGGAACCAGAGAGAGGCAGG - Intronic
1178452422 21:32715174-32715196 AAATAAAAACAAAAAGAGGCCGG + Intronic
1179147546 21:38781619-38781641 AAGAGAAATCAAAATGTGGCTGG - Intergenic
1179387740 21:40958237-40958259 AAGTGAAAGAAAAGAGAGGCTGG - Intergenic
1179608915 21:42536361-42536383 AAGTGGGATCAAGAATGGGCTGG - Intronic
1179650194 21:42803464-42803486 AAGTGAAAGCGAAGAGAGGCTGG + Intergenic
1181473274 22:23153665-23153687 AAGTGGAAGGAAAGTGAGGCTGG - Intronic
1182024463 22:27107121-27107143 AAGTGGACCCAAAAAGAGAAGGG + Intergenic
1182482263 22:30616822-30616844 GAGTGGAGCCAAGAAGAGGCAGG + Intronic
1182607256 22:31515677-31515699 AATAGGAATCACAATGAGGCTGG - Intronic
1182732457 22:32506060-32506082 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
1182998772 22:34837601-34837623 AAGTGAAAGCGAAGAGAGGCTGG - Intergenic
1183029003 22:35087933-35087955 AAGAGGAATGGAAAAGATGCAGG + Intergenic
1183285619 22:36960890-36960912 AAGTGGAATGAGAATGAGGGTGG - Intergenic
1183819625 22:40334843-40334865 AAAGGGCATCAAAAAGAGGCTGG + Exonic
1184994140 22:48192156-48192178 AAGTAGGATCAATAGGAGGCTGG - Intergenic
949190213 3:1242230-1242252 AAGTGAAAGCAAAGAGAGGCTGG + Intronic
949365713 3:3278397-3278419 AAGGGGAAAAAAAAAGAGGATGG - Intergenic
949600635 3:5594614-5594636 AATGGAAAACAAAAAGAGGCAGG - Intergenic
950313628 3:11980568-11980590 AAGTGGAATCAACAAGACTTAGG + Intergenic
950926666 3:16747604-16747626 TAGTGAAAGCAAAGAGAGGCTGG - Intergenic
951298643 3:20969930-20969952 AAGTGAAAGCAAAGAAAGGCTGG + Intergenic
951316150 3:21191620-21191642 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
951597700 3:24335922-24335944 AGGTGGGATGAAGAAGAGGCTGG + Intronic
951762615 3:26162794-26162816 AAGTGAAAGCGAAGAGAGGCTGG + Intergenic
951847304 3:27098071-27098093 AAATGAAAGCAGAAAGAGGCAGG + Intergenic
952343400 3:32463840-32463862 AAGTGAAAGCGAAGAGAGGCTGG + Intronic
952564846 3:34642307-34642329 AAGTGAAAGCGAAGAGAGGCTGG + Intergenic
952663290 3:35876748-35876770 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
952792012 3:37207373-37207395 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
952895047 3:38073090-38073112 AGGTGAAAGCAAAGAGAGGCTGG + Intronic
952895877 3:38078698-38078720 AAGTGAAAGCAAAGAGAGGCTGG + Intronic
953076951 3:39580222-39580244 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
953115218 3:39986259-39986281 AAGTGTAACCAGAATGAGGCTGG - Intronic
953177379 3:40564264-40564286 AAGTGAAAGCAAAGAGAGGCTGG - Intronic
953825528 3:46248731-46248753 AAGTGAAAGCAAAGAGAGGCTGG + Intronic
954158339 3:48701071-48701093 AAGTGGAATGACAACGTGGCTGG + Intronic
954528027 3:51290716-51290738 AAATGGAAACAAAAAGAGCAGGG + Intronic
954671619 3:52294170-52294192 AAGGGGGCTCAAAAGGAGGCAGG - Intergenic
954969097 3:54636912-54636934 AAGTGAAAGCAAAGAGAGGCTGG + Intronic
955253547 3:57306969-57306991 AAGTGAAAGCGAAGAGAGGCTGG - Intronic
956233333 3:67041104-67041126 AAGTGAAATCAAAGAGAGGCTGG + Intergenic
956548823 3:70437284-70437306 AGGTGAAAGCAAAGAGAGGCTGG + Intergenic
956709388 3:72026280-72026302 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
957295407 3:78327093-78327115 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
957317133 3:78585566-78585588 AAGTGAAAGCGAAGAGAGGCTGG + Intergenic
957451611 3:80388168-80388190 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
958208340 3:90434480-90434502 AAAGGAAAACAAAAAGAGGCAGG - Intergenic
958676627 3:97275402-97275424 AAGTGAAAGCAAAGAGAGGCTGG + Intronic
959485602 3:106925147-106925169 AAGTGAAAGCGAAGAGAGGCTGG + Intergenic
959972089 3:112419983-112420005 AAGTGAAAGCGAAGAGAGGCTGG + Intergenic
960156181 3:114298945-114298967 AAGTGGAAGCAAGAAGATGCAGG - Intronic
960282698 3:115795922-115795944 AAGTGAAAGCGAAGAGAGGCTGG + Intergenic
960309949 3:116107740-116107762 AAGTGAAAGCGAAGAGAGGCTGG + Intronic
960537482 3:118829157-118829179 AAGAAGAAACAAAAAGAGGGAGG + Intergenic
961132930 3:124485524-124485546 AAGTGGAAAAATAAAGTGGCAGG + Intronic
961164588 3:124754980-124755002 AAGTGAAGGCAAAGAGAGGCTGG + Intergenic
961293659 3:125866881-125866903 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
961711449 3:128831616-128831638 AAGTAAAAGCAAAGAGAGGCTGG + Intergenic
961730758 3:128962988-128963010 AAGTGAAGGCAAAGAGAGGCTGG - Intronic
961881219 3:130062554-130062576 AAGTGAAAGCGAAGAGAGGCTGG - Intergenic
962022083 3:131511973-131511995 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
962397410 3:135029049-135029071 AAGGGAAAACAAAAAAAGGCAGG - Intronic
963058800 3:141208256-141208278 AAGTGAAAGCGAAGAGAGGCTGG - Intergenic
963339968 3:144021823-144021845 AATGGGAAACAAAAAAAGGCAGG - Intronic
963425392 3:145116272-145116294 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
963456493 3:145553607-145553629 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
963468782 3:145713684-145713706 AAGTGAAAACGAAGAGAGGCTGG - Intergenic
963520614 3:146356840-146356862 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
963521791 3:146365345-146365367 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
963663521 3:148154939-148154961 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
963684502 3:148417636-148417658 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
963775928 3:149439990-149440012 AACTGGAATCAAAAATATTCAGG + Intergenic
963980488 3:151531006-151531028 AATGGGAAGCAAAAAAAGGCAGG + Intergenic
964125281 3:153229111-153229133 AAGTGAAAGCGAAGAGAGGCTGG + Intergenic
964175851 3:153825690-153825712 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
964262925 3:154860470-154860492 AAGTGGGTTAAAAAGGAGGCTGG - Intergenic
964578141 3:158198315-158198337 AATGGGAAACAAAAAAAGGCAGG - Intronic
964940787 3:162156557-162156579 AAGTGAGAGCAAAGAGAGGCTGG + Intergenic
965262483 3:166503204-166503226 AGGTGAAAGCAAAGAGAGGCTGG + Intergenic
965286561 3:166826517-166826539 AAGTGAAAGCAAAGAGAGTCTGG + Intergenic
965336503 3:167434507-167434529 AGGTGAAAGCAAAGAGAGGCTGG - Intergenic
965626145 3:170685752-170685774 AAGTGAAAGCGAAGAGAGGCTGG + Intronic
965639862 3:170820385-170820407 AGGTGAAAGCAAAGAGAGGCTGG + Intronic
965713589 3:171579706-171579728 AAGTGAAGGCAAAGAGAGGCTGG - Intergenic
965861810 3:173158381-173158403 AAGTGAAAGCCAAGAGAGGCTGG + Intergenic
966031727 3:175357125-175357147 AAGTGGAATAAAAAATAGTGAGG - Intronic
966067005 3:175830982-175831004 AAGTGAAAGCCAAGAGAGGCTGG - Intergenic
966085597 3:176064626-176064648 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
966104924 3:176324062-176324084 AAGTGAAAGCCAAGAGAGGCTGG + Intergenic
966232679 3:177668273-177668295 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
966279481 3:178210825-178210847 AAGTGAAAGCGAAGAGAGGCTGG - Intergenic
966398266 3:179523343-179523365 AAGTGAAAGCGAAGAGAGGCTGG + Intergenic
967000911 3:185333755-185333777 AAATAGAAAGAAAAAGAGGCTGG + Intronic
967005177 3:185376957-185376979 AAGTGAAAGCAAAGAGAGGCTGG + Intronic
967117916 3:186358556-186358578 AGGTGGAAACAAAATGTGGCTGG - Intronic
967152297 3:186661306-186661328 AAGTGAAAACAAAGAGAGGCTGG - Intronic
967211988 3:187177951-187177973 AAGTGAAAGCGAAGAGAGGCTGG + Intronic
967244008 3:187468694-187468716 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
967285476 3:187864661-187864683 AAATGAAAACAAAAAAAGGCAGG + Intergenic
967496397 3:190147789-190147811 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
967643646 3:191897763-191897785 AAGTGAAAACAAAGAGAGGCTGG + Intergenic
967740647 3:192998974-192998996 AACTGAAAACAAAGAGAGGCTGG - Intergenic
969653909 4:8485200-8485222 AGGTGAAAGCAAAGAGAGGCTGG + Intronic
969810272 4:9642142-9642164 AAGTGAAAGCGAAGAGAGGCTGG - Intergenic
970022093 4:11581203-11581225 AAGGGAAAACAAAAAAAGGCAGG - Intergenic
970042250 4:11809566-11809588 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
970087715 4:12367054-12367076 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
970256240 4:14172945-14172967 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
970532911 4:17000951-17000973 AAGTGAAAGCGAAGAGAGGCTGG - Intergenic
970583426 4:17493624-17493646 AGGTGGAATGACACAGAGGCAGG + Intronic
970853880 4:20632716-20632738 AAGTGAAAGCGAAGAGAGGCTGG + Intergenic
970958083 4:21838252-21838274 AAGTGACATCAAAAAAAGTCCGG + Intronic
971180728 4:24326497-24326519 AAGTGAAAGCGAAGAGAGGCTGG - Intergenic
971200309 4:24504299-24504321 AAGTGAAAGCGAAGAGAGGCTGG - Intergenic
971438452 4:26653697-26653719 AATGGGAAACAAAAAAAGGCAGG - Intronic
972314565 4:37914004-37914026 AAGTTGAAGGAAAAACAGGCAGG - Intronic
973913628 4:55610164-55610186 AAGTTAAATGAAAAAGAGGTCGG + Intronic
974155219 4:58062519-58062541 AAATGGAATAAAAGAGAGGTGGG + Intergenic
974173259 4:58293737-58293759 AAGTGAAAGCGAAGAGAGGCTGG + Intergenic
974238210 4:59208770-59208792 AATGGAAAACAAAAAGAGGCAGG + Intergenic
974428228 4:61766722-61766744 AAGTGAAAGCGAAGAGAGGCTGG + Intronic
975157464 4:71088229-71088251 AAATGGAAAAAAAAAAAGGCAGG - Intergenic
975295797 4:72732681-72732703 AATTGAAAACAAAAAAAGGCAGG + Intergenic
975864918 4:78716282-78716304 AAGTGAAAGCGAAGAGAGGCTGG + Intergenic
975933715 4:79556399-79556421 AAGTGAAAGCGAAGAGAGGCTGG + Intergenic
976337291 4:83905062-83905084 CAGTGGGATCAAAATGAAGCAGG - Intergenic
976558736 4:86477873-86477895 AAGTGAAAGCAAAGAGAGGCTGG - Intronic
976696714 4:87925152-87925174 AAGTGAAAGCGAAGAGAGGCTGG - Intergenic
976739783 4:88346185-88346207 AAGTGAAAACAAAGAGAGGCTGG + Intergenic
976884396 4:89967219-89967241 AAGTGAAAGCGAAGAGAGGCTGG + Intergenic
977010487 4:91627368-91627390 AAGTGAAAGCGAAAAGAGGCTGG - Intergenic
977062331 4:92273924-92273946 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
977075031 4:92441389-92441411 AAGTGAAAGCGAAGAGAGGCTGG + Intronic
977198258 4:94087054-94087076 AAGTGAAAGCGAAGAGAGGCTGG + Intergenic
977216981 4:94295654-94295676 AAGTGAAAGCAAAGAGAGACTGG + Intergenic
978000949 4:103556185-103556207 AAGTGAAAGCGAAGAGAGGCTGG + Intergenic
978216885 4:106215533-106215555 AAGGGAAAACAAAAAAAGGCAGG + Intronic
978386465 4:108180450-108180472 AAGAGGAAGCAAAAAGAAGAGGG + Intergenic
978438790 4:108712438-108712460 AAGTGAAAGCGAAGAGAGGCTGG - Intergenic
978852298 4:113353749-113353771 AAGCAGAAACAAAAAGAGGAAGG + Exonic
979146784 4:117255380-117255402 AAGTGAAAGCGAAGAGAGGCTGG - Intergenic
979171238 4:117602738-117602760 AAGTGAAAGCGAAGAGAGGCCGG + Intergenic
979380114 4:119997210-119997232 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
979840146 4:125428926-125428948 AGATGCAATCACAAAGAGGCAGG - Intronic
979850134 4:125564055-125564077 AAGTGAAAGCGAAGAGAGGCTGG + Intergenic
979938714 4:126731838-126731860 AAGAAGAAAAAAAAAGAGGCTGG + Intergenic
979975611 4:127192591-127192613 AAGTAGCACCAAAAAGAGGAAGG - Intergenic
980111745 4:128643289-128643311 AAGTGAAAGCGAAGAGAGGCTGG + Intergenic
980472265 4:133266115-133266137 AAGTGAAAGCGAAGAGAGGCTGG + Intergenic
980528036 4:134015454-134015476 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
980575454 4:134680335-134680357 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
980611604 4:135169722-135169744 AAGTGAAAGCGAAGAGAGGCTGG + Intergenic
980904113 4:138931152-138931174 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
981040414 4:140216782-140216804 AAGTGAAAGCGAAGAGAGGCTGG - Intergenic
981100451 4:140824178-140824200 AAATGGAAACAAAAAAAGGCAGG - Intergenic
981525386 4:145702377-145702399 AAGTGAAGGCAAAGAGAGGCTGG - Intronic
981539895 4:145836035-145836057 AAGTGAAAGCGAAGAGAGGCTGG - Intronic
981747919 4:148068862-148068884 AAGTAGCACCAAAGAGAGGCAGG - Intronic
982083804 4:151815035-151815057 AGGTGAAAGCAAAGAGAGGCTGG + Intergenic
982396558 4:154921266-154921288 AAGTGAAAGCGAAGAGAGGCTGG + Intergenic
982496942 4:156105904-156105926 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
982922073 4:161288368-161288390 AAGAAAAATCAAAAAGAGGCCGG + Intergenic
983024050 4:162712386-162712408 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
983056447 4:163103206-163103228 AAGTGAAAGCGAAGAGAGGCTGG + Intergenic
983288481 4:165770068-165770090 AAGTGGCATGGAAAAGATGCTGG + Intergenic
983345726 4:166523812-166523834 AGGTGAAAGCAAAGAGAGGCTGG - Intergenic
983360583 4:166719592-166719614 AAGTGAAAGCGAAGAGAGGCTGG - Intergenic
983414543 4:167438232-167438254 AAGTGAAAGCGAAGAGAGGCTGG + Intergenic
983452505 4:167926178-167926200 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
983659745 4:170119738-170119760 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
983688001 4:170433601-170433623 AAATGGAAACAAAAAAAGGCAGG + Intergenic
983707840 4:170680781-170680803 AAGTGAAAGCGAAGAGAGGCTGG - Intergenic
983805620 4:171988453-171988475 AAGTGAAAGCGAAGAGAGGCTGG + Intronic
983883586 4:172958791-172958813 AAGTGAAAGCGAAGAGAGGCTGG + Intronic
984165183 4:176297273-176297295 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
984322359 4:178210376-178210398 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
984700850 4:182817806-182817828 AAGTGAAGGCAAAGAGAGGCTGG - Intergenic
984765352 4:183396582-183396604 AAGTGGAAACAGAAACAGGAAGG - Intergenic
985057221 4:186046625-186046647 AAGTGAAGGCAAAGAGAGGCTGG + Intergenic
985078833 4:186244536-186244558 AAGTGAAAGCGAAGAGAGGCTGG + Intronic
985582524 5:706073-706095 AAGTGAAGGCAAAGAGAGGCTGG - Intergenic
986193700 5:5518831-5518853 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
986389050 5:7266873-7266895 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
986602116 5:9482768-9482790 AAGTGGAACTGAAAAGAAGCTGG + Intronic
986775208 5:11007984-11008006 AACTGGAATGGAAAAGAGCCAGG - Intronic
986905937 5:12493033-12493055 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
987282172 5:16423006-16423028 AAGTGAAAGCGAAGAGAGGCTGG - Intergenic
987497954 5:18671280-18671302 AAGTGAAAGCGAAGAGAGGCTGG + Intergenic
987755996 5:22098125-22098147 AAGTGAAAGCAAAGAGAGGCTGG - Intronic
988199271 5:28048930-28048952 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
988384967 5:30551243-30551265 AAGTGAGATGAAAAAGGGGCAGG + Intergenic
988645037 5:33085595-33085617 AAGTAGCATCAACTAGAGGCAGG + Intergenic
989113236 5:37927433-37927455 AAGTGCAATCTAAAATAGACAGG - Intergenic
989180967 5:38576524-38576546 AAGTGGAACCAAGAAAATGCTGG - Intronic
989655634 5:43745041-43745063 AAATGAAAACAAAAAAAGGCAGG - Intergenic
989660094 5:43789390-43789412 AAGTGAAAGCAAAGACAGGCTGG - Intergenic
989950732 5:50294263-50294285 AATGGGAAACAAAAAAAGGCAGG - Intergenic
991529721 5:67602150-67602172 AAATGGAAACTAAAAAAGGCAGG - Intergenic
991951682 5:71952791-71952813 AAGCTGAATTAGAAAGAGGCTGG + Intergenic
992154895 5:73945379-73945401 AAGTGGAGAAAAAAAGAGACAGG + Intergenic
992394839 5:76360643-76360665 AAGTGAAAGCGAAGAGAGGCTGG - Intergenic
993192890 5:84701764-84701786 AAGTGAAAGCGAAGAGAGGCTGG - Intergenic
993836866 5:92827247-92827269 AAGTGAAAGCGAAGAGAGGCTGG - Intergenic
994290626 5:98024919-98024941 AATGGAAAACAAAAAGAGGCAGG + Intergenic
994295312 5:98082354-98082376 AAGTGAAAGCGAAGAGAGGCTGG - Intergenic
994532375 5:100986680-100986702 AAGTGAAAGCAAGGAGAGGCTGG + Intergenic
994778779 5:104066624-104066646 AAGTGAAAGCGAAGAGAGGCTGG + Intergenic
994989721 5:106981651-106981673 AAGTGAAAGCGAAGAGAGGCTGG - Intergenic
995029460 5:107464103-107464125 CATGGGATTCAAAAAGAGGCAGG + Intronic
995119806 5:108523513-108523535 AAGGGGAACCAAAAAGAGTGAGG - Intergenic
995122682 5:108552561-108552583 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
995296845 5:110533127-110533149 AGGTGAAAGCAAAGAGAGGCTGG - Intronic
995341829 5:111069695-111069717 AAGAGGAAACAAAAAAAGGGAGG + Intergenic
995690571 5:114821921-114821943 AAGTAGAAAAAAAAAGAGGGAGG - Intergenic
995808811 5:116082493-116082515 AATGGGAAGCAAAAAGAAGCCGG + Intergenic
995899199 5:117048797-117048819 AAGTGAAAGCAAAGAGACGCTGG + Intergenic
996052456 5:118949318-118949340 AAGTGAAAGCAAAGAGAGGCTGG + Intronic
996344649 5:122476026-122476048 AAGTGAAAGCGAAGAGAGGCTGG + Intergenic
996358446 5:122621291-122621313 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
996510066 5:124307074-124307096 AAGTGAAAACGAAGAGAGGCTGG - Intergenic
996574814 5:124969034-124969056 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
996745265 5:126841977-126841999 AAGTGAAAGCGAAGAGAGGCTGG + Intergenic
997648489 5:135497589-135497611 AAGTGGAAAACAAAGGAGGCAGG + Intergenic
997704499 5:135934356-135934378 AAGTGAAATCAAATGGAGGTTGG + Intronic
997746572 5:136304598-136304620 AAGTGAAAGCAAAGAGAGGCTGG - Intronic
997769514 5:136542034-136542056 AAGTGAAGGCAAAGAGAGGCTGG + Intergenic
997770458 5:136548752-136548774 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
997805814 5:136916696-136916718 GAGTGAAAACAAAAAAAGGCAGG - Intergenic
998594952 5:143519156-143519178 ATATGGAACCAAAAAGAGCCTGG - Intergenic
998995560 5:147866575-147866597 AAGTGAAAGCGAAGAGAGGCTGG - Intergenic
998996229 5:147871409-147871431 AAGTGAAAGCGAAGAGAGGCTGG + Intronic
999320807 5:150613952-150613974 ATGGGGAATCAGAAGGAGGCTGG + Intronic
999590991 5:153145654-153145676 AAGAGAAATCAAAAACAAGCAGG + Intergenic
999618698 5:153452131-153452153 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
999936282 5:156489045-156489067 AAATGGAAACCAAAAGAAGCAGG + Intronic
1000439892 5:161251780-161251802 AAGTGAAAGCGAAGAGAGGCTGG - Intergenic
1000519236 5:162277826-162277848 AAGTGAAAGCGAAGAGAGGCTGG + Intergenic
1000836497 5:166161183-166161205 AAATGGGATTAAAAATAGGCTGG + Intergenic
1000885151 5:166741519-166741541 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
1000935471 5:167300348-167300370 AAGTGAAAGCGAAGAGAGGCTGG + Intronic
1001063359 5:168513767-168513789 AGGTGGAATCAAAAAACTGCAGG - Intronic
1001331278 5:170764468-170764490 AAGTGAAAGCAAAGAGACGCTGG + Intronic
1002531070 5:179845790-179845812 AAAAAGAACCAAAAAGAGGCCGG - Intronic
1002610775 5:180417150-180417172 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
1002693914 5:181071362-181071384 AAATGGCATGGAAAAGAGGCTGG - Intergenic
1002731638 5:181338968-181338990 GAGAGGAGTCGAAAAGAGGCTGG + Intergenic
1002752893 6:135126-135148 GAGAGGAGTCGAAAAGAGGCTGG - Intergenic
1003099912 6:3169151-3169173 AGGTGAAAGCAAAGAGAGGCTGG - Intergenic
1003430001 6:6030214-6030236 AAGTGAAAGCGAAGAGAGGCTGG + Intergenic
1003595364 6:7469594-7469616 AAAAAAAATCAAAAAGAGGCAGG - Intergenic
1003626442 6:7745804-7745826 AGGTGAAAAAAAAAAGAGGCCGG + Intronic
1004106433 6:12670646-12670668 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
1004283347 6:14299380-14299402 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
1004768400 6:18756493-18756515 AAGTGAAAGCGAAGAGAGGCTGG + Intergenic
1004837174 6:19542190-19542212 AAGTGAAAGCGAAGAGAGGCTGG - Intergenic
1005256434 6:24008245-24008267 AAGAGGAATCCAAAAAAGCCTGG + Intergenic
1005786399 6:29249641-29249663 AAGTAAAGGCAAAAAGAGGCTGG + Intergenic
1005820294 6:29593037-29593059 AACAGGAAACAAAAAAAGGCAGG - Intronic
1006097419 6:31664798-31664820 AAGTGGTTTCAGAAAGAGGCTGG - Intronic
1006238006 6:32652694-32652716 AAGTGGAAGCATAAAGTGGAGGG + Intergenic
1006254909 6:32823214-32823236 AAGTGGACAAAAAAATAGGCTGG - Intronic
1007824293 6:44587989-44588011 AATGGGAAACAAAAAAAGGCAGG - Intergenic
1007961748 6:45966644-45966666 AAAAGGAAACAAAAAGAGGAGGG - Intronic
1008212280 6:48739526-48739548 AAGGGAAAACAAAAAAAGGCAGG + Intergenic
1008476761 6:51941797-51941819 AAGTGAAAGCGAAGAGAGGCTGG - Intronic
1009269990 6:61603388-61603410 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
1009359522 6:62794794-62794816 AAGTGAAAGCGAAGAGAGGCTGG - Intergenic
1009379312 6:63008610-63008632 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
1009547285 6:65035992-65036014 ATATGGAACCAAAAAGAGCCTGG + Intronic
1009873996 6:69482507-69482529 AATGGGAAACAAAAAAAGGCAGG + Intergenic
1010295037 6:74185640-74185662 AAGTAGAAGGAAAAGGAGGCAGG + Intergenic
1010662483 6:78586674-78586696 AAGTGAAAGCGAAGAGAGGCTGG - Intergenic
1010826689 6:80484548-80484570 AAGTGAAAGCGAAGAGAGGCTGG + Intergenic
1010894372 6:81347569-81347591 AAGTGAAGGCAAAGAGAGGCTGG + Intergenic
1011159102 6:84368361-84368383 AAATGGAAACAAAAAAAGGCAGG - Intergenic
1011198505 6:84807800-84807822 AAATGAAAGCAAAAAAAGGCTGG - Intergenic
1011289425 6:85761133-85761155 AATGGGAACCAAAAAAAGGCAGG - Intergenic
1011290836 6:85775501-85775523 CAATGGAAACAAAAAGAGGCAGG - Intergenic
1011367727 6:86600797-86600819 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
1011845274 6:91555307-91555329 AAGAGGAATCAAGAAGAGACTGG + Intergenic
1012014218 6:93832500-93832522 AAGTGAAAGCGAAGAGAGGCTGG + Intergenic
1012181178 6:96155136-96155158 AAGAGCATTCAAAAAAAGGCAGG - Intronic
1012315991 6:97782869-97782891 AAGTGAAAGCGAAGAGAGGCTGG - Intergenic
1012675265 6:102105239-102105261 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
1012689750 6:102296215-102296237 AAGTGAAGGCAAAGAGAGGCTGG - Intergenic
1012815249 6:104016021-104016043 AGGTGGAATCAGAAAAAGACAGG - Intergenic
1013459769 6:110364019-110364041 AGGGGGAACTAAAAAGAGGCAGG - Intergenic
1013811029 6:114044723-114044745 CAGTGGACTCAAAGAGAAGCAGG - Intergenic
1013843533 6:114424899-114424921 AAGTGAAAGCAAGGAGAGGCTGG + Intergenic
1013891884 6:115035168-115035190 AAGTGAAAGCGAAGAGAGGCTGG - Intergenic
1014387546 6:120820027-120820049 AAATGGAAACAAAAAAAGGCAGG + Intergenic
1014502588 6:122210820-122210842 AAGTGGAACCAAGAAGGGACGGG + Intergenic
1014556019 6:122843113-122843135 AAGTGAAAGCGAAGAGAGGCTGG - Intergenic
1014563183 6:122915278-122915300 AAATGGAAACCAAAAGAGACAGG - Intergenic
1014614499 6:123584716-123584738 AAGTGAAAGCCAAGAGAGGCTGG + Intronic
1014619596 6:123649316-123649338 AAGTTGAATCAAAAACAGACAGG + Intergenic
1014719069 6:124895325-124895347 AAGTGAAGGCAAAGAGAGGCTGG - Intergenic
1014793817 6:125704287-125704309 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
1014891718 6:126852032-126852054 AAGTGAAAGAAAATAGAGGCTGG - Intergenic
1015165390 6:130195625-130195647 AAGTGAAAGCGAAGAGAGGCTGG - Intronic
1015266917 6:131298736-131298758 AAGTGAAAGCGAAGAGAGGCTGG - Intergenic
1015269825 6:131326681-131326703 AAGTGAAAGCGAAGAGAGGCTGG - Intergenic
1015271544 6:131342155-131342177 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
1015278328 6:131406101-131406123 AAGTGAAAGCGAAGAGAGGCTGG - Intergenic
1015324001 6:131904971-131904993 AAGTGAAAGCGAAGAGAGGCTGG - Intergenic
1015801207 6:137063747-137063769 AAGTGAAAGCGAAGAGAGGCTGG + Intergenic
1016113974 6:140259871-140259893 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
1016226786 6:141748195-141748217 AATGGGAAACAAAAAAAGGCAGG + Intergenic
1016249036 6:142019094-142019116 AAGTGAAAGCGAAGAGAGGCTGG - Intergenic
1016452173 6:144194631-144194653 AACTGGGAGCAAACAGAGGCTGG + Intergenic
1016518976 6:144926456-144926478 AAGTGAAAGCGAAGAGAGGCTGG - Intergenic
1016535586 6:145105576-145105598 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
1016650113 6:146452846-146452868 AAGTGAAAGCGAAGAGAGGCTGG + Intergenic
1016853445 6:148643088-148643110 AAGTGAAAACGAAGAGAGGCTGG - Intergenic
1017389679 6:153924773-153924795 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
1017657730 6:156645957-156645979 AAGTTAGATCAAAAAGAGGAAGG + Intergenic
1017779173 6:157703078-157703100 AAGTGAAAGCAAAGAGAGGCTGG + Intronic
1017832315 6:158141668-158141690 AGGAAGAATCAAAAAGAGCCAGG + Intronic
1017848693 6:158283541-158283563 AAGTTGAATCAAATTCAGGCAGG - Intronic
1017942306 6:159063680-159063702 AAGAGGCTTCAAGAAGAGGCCGG + Intergenic
1018084323 6:160288998-160289020 AAGTGAAAGCGAAGAGAGGCTGG + Intergenic
1018135885 6:160778168-160778190 AAGTGAAAGCAAAGGGAGGCTGG - Intergenic
1018297503 6:162364746-162364768 AAGGGGAATCAGGAAGAGGGAGG + Intronic
1018925342 6:168201952-168201974 AGGTGGATTCACAAAAAGGCAGG - Intergenic
1019693236 7:2429370-2429392 AAGTACAAAAAAAAAGAGGCCGG - Intronic
1020153819 7:5705289-5705311 AAATGGAATCCAAAAGATTCAGG - Intronic
1020316220 7:6907066-6907088 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
1020532545 7:9355847-9355869 AAGTGAAAGCGAAGAGAGGCTGG + Intergenic
1020540969 7:9460984-9461006 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
1020786308 7:12577552-12577574 AAGCAGAAACAAAAACAGGCCGG + Intronic
1020954937 7:14729001-14729023 AAATGTATACAAAAAGAGGCTGG - Intronic
1021172849 7:17417136-17417158 AAGTGAAAGCAGAGAGAGGCTGG - Intergenic
1021430021 7:20548728-20548750 AAGTGAAAGCGAAGAGAGGCTGG - Intergenic
1021637492 7:22706527-22706549 AGGTGAAAGCAAAGAGAGGCTGG - Intergenic
1021810824 7:24399564-24399586 AAGTGAAAGCGAAGAGAGGCTGG - Intergenic
1021977732 7:26026619-26026641 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
1022352881 7:29582113-29582135 AAGGGAAAACAAAAAAAGGCAGG + Intergenic
1022373047 7:29788126-29788148 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
1022447579 7:30482517-30482539 AAGTGAGAGCAAAGAGAGGCTGG - Intergenic
1022549587 7:31226459-31226481 AACTGGGAACAAAAAGAGGTTGG - Intergenic
1022709246 7:32835657-32835679 AAGTGAAAGCGAAGAGAGGCTGG - Intergenic
1022709865 7:32840337-32840359 AAGTGAAGGCAAAGAGAGGCTGG + Intergenic
1023679055 7:42664857-42664879 AAGGGGGATAAAAAGGAGGCAGG + Intergenic
1023698716 7:42873039-42873061 AAGTGAAAGCGAAGAGAGGCTGG + Intergenic
1024192214 7:47024143-47024165 AAGTGAAATCCACTAGAGGCTGG + Intergenic
1024762124 7:52611351-52611373 AAATGGAATGAAATGGAGGCAGG - Intergenic
1025600968 7:62997029-62997051 AATGGGAAACAAAAAAAGGCAGG - Intergenic
1026369352 7:69683300-69683322 ACGTGGCAACAAAAAGTGGCAGG + Intronic
1028170641 7:87591399-87591421 AAGAGGGATGATAAAGAGGCAGG + Intronic
1028369271 7:90072269-90072291 AATAGGAAGCAAAAAAAGGCAGG + Intergenic
1028656045 7:93208169-93208191 AAGGGGAATCAAATAGAAGTAGG + Intronic
1028670676 7:93397219-93397241 AAGTGAAAGCAGAGAGAGGCTGG - Intergenic
1028690343 7:93643144-93643166 AAGTGAAAGCAAAGAGAGGCTGG - Intronic
1029263679 7:99322280-99322302 AGGGGGAAGCAAAAAGAAGCAGG + Intergenic
1029288573 7:99484167-99484189 GAGTGGAATCAGGAAGAGGAAGG + Intronic
1029500382 7:100925446-100925468 AAGTGAAAGCGAAGAGAGGCTGG - Intergenic
1030163442 7:106530857-106530879 AAGTGAAAGCGAAAAGAGCCTGG + Intergenic
1030507924 7:110447694-110447716 AAGGGGAAAGAAAAAAAGGCAGG - Intergenic
1030751330 7:113236010-113236032 AAGTGAAGGCAAAGAGAGGCTGG + Intergenic
1031004846 7:116458791-116458813 AAGTGAAAGCAAAGAGAGGCTGG - Intronic
1031355017 7:120779566-120779588 AAGTGAAAGCGAAGAGAGGCTGG + Intergenic
1031364589 7:120888051-120888073 AAGTGAAAGCGAAGAGAGGCTGG + Intergenic
1031400153 7:121318840-121318862 AAGTGAAAGCGAAGAGAGGCTGG - Intergenic
1031686016 7:124732318-124732340 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
1031699260 7:124902842-124902864 AAATGGAAACAAAAAAAAGCAGG + Intronic
1031727772 7:125261332-125261354 AAGTGAAAGCGAAGAGAGGCTGG + Intergenic
1031941840 7:127797626-127797648 AATTGAAAACAAAAAGATGCTGG - Intronic
1032772079 7:135069044-135069066 AAATGAAAACAAAAAAAGGCAGG + Intronic
1033464869 7:141581250-141581272 AAGTGAAAGCAAAGAGAGGCTGG + Intronic
1033675775 7:143539648-143539670 AAGTGAAAGCGAAGAGAGGCTGG + Intergenic
1033696059 7:143789796-143789818 AAGTGAAAGCGAAGAGAGGCTGG - Intergenic
1033909299 7:146245807-146245829 AAGTGAAAGCGAAGAGAGGCTGG + Intronic
1034084647 7:148312474-148312496 AAGTGAAAGCAAAGAGAGGCTGG + Intronic
1034226200 7:149485423-149485445 AAGTGCAGTGAAAAAGAAGCAGG + Intronic
1034283455 7:149869136-149869158 CAGTGGAATCAAAAGGACTCAGG + Intergenic
1034454618 7:151160817-151160839 GAGTGTAGTAAAAAAGAGGCGGG - Intronic
1034998775 7:155594977-155594999 AAGGGAAATCACACAGAGGCAGG + Intergenic
1035447073 7:158950391-158950413 ACCTGGAATCATATAGAGGCTGG - Intronic
1035447118 7:158950696-158950718 ACCTGGAATCATATAGAGGCTGG - Intronic
1035447136 7:158950818-158950840 ACCTGGAATCATATAGAGGCTGG - Intronic
1035447154 7:158950940-158950962 ACCTGGAATCATATAGAGGCTGG - Intronic
1035511878 8:195311-195333 GAGAGGAGTCAAAAAGAGGCTGG - Intronic
1036070745 8:5439063-5439085 AAGTGAAAGCGAAGAGAGGCTGG + Intergenic
1036113147 8:5928621-5928643 AATTGAAAACAAAAAAAGGCAGG - Intergenic
1036186171 8:6624237-6624259 AGGAGGAAAGAAAAAGAGGCTGG - Intronic
1036281651 8:7405720-7405742 AAGTGGAAGCGAAGAGAGGCTGG - Intergenic
1036339819 8:7905852-7905874 AAGTGGAAGCAAAGAGAGGCTGG + Intergenic
1036639655 8:10574552-10574574 AGGTGAAAGCAAAGAGAGGCTGG - Intergenic
1037165621 8:15824863-15824885 CAGTCCAATTAAAAAGAGGCAGG - Intergenic
1037183549 8:16034802-16034824 AAGTGGAAAACAAAAAAGGCAGG + Intergenic
1038902065 8:31855436-31855458 AATGGGAAACAAAAAAAGGCAGG - Intronic
1039097344 8:33900870-33900892 AATGGAAAACAAAAAGAGGCAGG - Intergenic
1039099002 8:33920849-33920871 AAGTGGAAACAGAGAGAGGGAGG + Intergenic
1039718970 8:40142017-40142039 AATGGAAAACAAAAAGAGGCAGG - Intergenic
1040094028 8:43426029-43426051 AATGGAAAACAAAAAGAGGCAGG + Intergenic
1040538416 8:48329837-48329859 AAATGGAAGCACAGAGAGGCTGG - Intergenic
1040690830 8:49936641-49936663 AAGTGGAATGAGTAAGTGGCAGG - Intronic
1041465083 8:58150510-58150532 AAATGGAATGAGGAAGAGGCCGG - Intronic
1041917365 8:63150748-63150770 AAGCGAAAGCAAAGAGAGGCTGG + Intergenic
1042115688 8:65428657-65428679 AAATGGAAACAGAAAAAGGCAGG + Intergenic
1042317863 8:67443365-67443387 AAGAGGAAGCAAGAATAGGCAGG - Intronic
1042453735 8:68976459-68976481 AAGTGAAGGCAAAGAGAGGCTGG - Intergenic
1042673497 8:71289936-71289958 ATGTGGAAAAAAAGAGAGGCGGG + Intronic
1042707547 8:71678198-71678220 AAGTGAAAGCGAAGAGAGGCTGG - Intergenic
1043045257 8:75314999-75315021 GAGTGAAAGCAAAAAGAGGATGG + Intergenic
1043196963 8:77307336-77307358 AAGGAGAATCAAAAAGAGAATGG + Intergenic
1043335833 8:79175719-79175741 AAGAGGAATTTAAAAGAAGCAGG - Intergenic
1043338283 8:79204330-79204352 CAGTGGGATCAAAATGAAGCAGG + Intergenic
1043353494 8:79388528-79388550 AAGTGAAAGCGAAGAGAGGCTGG + Intergenic
1043717729 8:83507575-83507597 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
1043790105 8:84455061-84455083 AAGGGGAATAAAAATGAGCCAGG + Intronic
1044148349 8:88744637-88744659 AAGTGAAAGCGAAGAGAGGCTGG + Intergenic
1044258449 8:90092637-90092659 AAGTGAAGACAAAGAGAGGCTGG + Intronic
1044417265 8:91951247-91951269 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
1044922167 8:97178363-97178385 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
1044925331 8:97204203-97204225 AAGTGAAAGCGAAGAGAGGCTGG - Intergenic
1045197700 8:99947158-99947180 AAGTGAAAGCGAAGAGAGGCTGG - Intergenic
1045677018 8:104618458-104618480 AATTGGAATGAAGAAGAGGGAGG + Intronic
1046294292 8:112199111-112199133 AAGTGAAAGCGAAGAGAGGCTGG - Intergenic
1046440186 8:114244625-114244647 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
1046443422 8:114285273-114285295 AAGTGAAAGCGAAGAGAGGCTGG - Intergenic
1046512250 8:115215512-115215534 AAGTGGAAGTGAAGAGAGGCTGG - Intergenic
1046559448 8:115817885-115817907 AAGTGAAGGCAAAGAGAGGCTGG - Intergenic
1047146941 8:122212566-122212588 AAGTGGAATTAAGATAAGGCAGG + Intergenic
1047296425 8:123574445-123574467 AAGATAAATCAACAAGAGGCAGG + Intergenic
1047371248 8:124257828-124257850 AAATAAAATAAAAAAGAGGCTGG + Intergenic
1047699526 8:127435004-127435026 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
1047837554 8:128710895-128710917 AATGGAAATCAAAAAAAGGCAGG - Intergenic
1047856551 8:128917700-128917722 AAGTGAAAGCGAAGAGAGGCTGG - Intergenic
1048097770 8:131313481-131313503 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
1048135633 8:131744008-131744030 AAGTGAAAGCGAAGAGAGGCTGG - Intergenic
1048143933 8:131822476-131822498 AAGTGAAAGCGAAGAGAGGCTGG - Intergenic
1048168257 8:132082658-132082680 AAGTGAAAGCAAAGAGAGGCTGG + Intronic
1048585255 8:135769575-135769597 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
1048728254 8:137410700-137410722 AGGTGAAAGCAAAGAGAGGCTGG + Intergenic
1049888900 9:48715-48737 GAGAGGAGTCGAAAAGAGGCTGG - Intergenic
1050306738 9:4312601-4312623 AAGTGCAATCAAGAAGAAACTGG - Intronic
1050896250 9:10888058-10888080 AAGTGAAAGCGAAGAGAGGCTGG - Intergenic
1051052801 9:12951631-12951653 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
1051324560 9:15950941-15950963 AATGGAAAACAAAAAGAGGCAGG + Intronic
1051584607 9:18713416-18713438 AAGTGGAAAACAAAAAAGGCAGG + Intronic
1051624478 9:19085722-19085744 ATGAGGAATCAAAATGAGTCTGG - Intronic
1051918719 9:22238329-22238351 AAAAGGAAACAAAAAGAGGGGGG - Intergenic
1051953237 9:22660993-22661015 AAGTGAAAGCGAAGAGAGGCTGG + Intergenic
1052163254 9:25290954-25290976 AAGTGAAAGCGAAGAGAGGCTGG - Intergenic
1052192002 9:25672205-25672227 AAGTGAAAGCGAAGAGAGGCTGG - Intergenic
1052238291 9:26240099-26240121 AGGTGGAATTAAAAAGAGAGGGG - Intergenic
1052255868 9:26455846-26455868 AAGAGGAAAAAAAAAAAGGCAGG - Intergenic
1052648077 9:31263869-31263891 ATGTGGAAAAAAAAAAAGGCTGG - Intergenic
1052653513 9:31329691-31329713 AAGTGAAAGCGAAGAGAGGCTGG - Intergenic
1052720469 9:32166952-32166974 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
1052899909 9:33784297-33784319 AAATGAAATGAAAAAGATGCTGG + Intronic
1053058201 9:35006771-35006793 AAGTGAAAGCGAAGAGAGGCTGG - Intergenic
1053485724 9:38454622-38454644 AAGTGGAAGCAGAATGGGGCTGG - Intergenic
1054807314 9:69407173-69407195 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
1055233242 9:74088947-74088969 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
1055626895 9:78184096-78184118 AAGTGAAAGCGAAGAGAGGCTGG - Intergenic
1055810226 9:80140699-80140721 AAGTGAAAGCGAAGAGAGGCTGG - Intergenic
1055881910 9:81012295-81012317 AAGTGAAAGCGAAGAGAGGCTGG - Intergenic
1056044561 9:82703143-82703165 AAGTGAAGGCAAAGAGAGGCTGG + Intergenic
1056061328 9:82887034-82887056 AAGTGAAAGCGAAGAGAGGCTGG - Intergenic
1056324065 9:85461931-85461953 AAGTGAAAGCGAAGAGAGGCTGG - Intergenic
1056363876 9:85883984-85884006 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
1056522620 9:87414210-87414232 AAGTGAAAGCGAAGAGAGGCTGG - Intergenic
1056883150 9:90415861-90415883 AAGTGAAAGCGAAGAGAGGCTGG - Intergenic
1057684171 9:97218120-97218142 AAGTGAAAGCGAAGAGAGGCTGG - Intergenic
1057982257 9:99673446-99673468 AAGTGAAGGCAAATAGAGGCTGG - Intergenic
1058026028 9:100143117-100143139 AAGTGAAAGCGAAGAGAGGCTGG + Intronic
1058145873 9:101410721-101410743 AATTAGAATCAAAAATAGGAAGG + Intergenic
1058612563 9:106791485-106791507 AGGTGAAAGCAAAGAGAGGCTGG - Intergenic
1059546005 9:115177046-115177068 AAGTGAAAGCAAAGAGAGGCTGG + Intronic
1059574788 9:115476633-115476655 AAGTGAAAGCGAAGAGAGGCTGG - Intergenic
1059575895 9:115488122-115488144 ATGTGGAGTCAAACAGAGCCAGG - Intergenic
1059863319 9:118488095-118488117 AAGTGAAAGCGAAGAGAGGCTGG + Intergenic
1060180840 9:121532638-121532660 AAGTAAAAGAAAAAAGAGGCCGG - Intergenic
1060226382 9:121793613-121793635 AAGTGAAAGCGAAGAGAGGCTGG - Intergenic
1060318302 9:122533060-122533082 AAGTGAAAGCGAAGAGAGGCCGG + Intergenic
1060737705 9:126077050-126077072 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
1061583241 9:131550357-131550379 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
1185656763 X:1691810-1691832 AAGTTAAATCATAAATAGGCTGG - Intergenic
1185960519 X:4542906-4542928 AAGTGAAGGCAAAGAGAGGCTGG + Intergenic
1185991227 X:4894869-4894891 AAGTGAAAGCAAAGGGAGGCTGG - Intergenic
1186112679 X:6274609-6274631 AAGTGAAAGCAAAGAGAAGCTGG + Intergenic
1186575324 X:10759496-10759518 AAGTGGCATCACAAAGGGGAAGG - Intronic
1187086350 X:16047113-16047135 AAGTGAAAGCGAAGAGAGGCTGG + Intergenic
1187506342 X:19881399-19881421 AATGGGAAGTAAAAAGAGGCAGG + Intronic
1188080246 X:25829784-25829806 AAGTGGATTCAAAAGGAAGACGG - Intergenic
1188463207 X:30451524-30451546 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
1188815558 X:34708927-34708949 AAGTCAAAACAAAAAGAGCCTGG + Intergenic
1188831249 X:34900031-34900053 AACTGGATTCTATAAGAGGCTGG + Intergenic
1188874549 X:35414065-35414087 GAGTGGAGTGAAAAAGAGGAAGG - Intergenic
1189402356 X:40682926-40682948 AAGTGCAATCAAGAAGAGAGCGG + Exonic
1189625324 X:42890530-42890552 AAATGGAAAAAAAAAAAGGCAGG + Intergenic
1189845742 X:45135046-45135068 AGGAGGAATCAAACAGAAGCAGG - Intergenic
1190704087 X:53011552-53011574 AAGAAGAAAAAAAAAGAGGCCGG - Intergenic
1190945082 X:55084733-55084755 AATTGAAAACAAAAAAAGGCAGG - Intergenic
1191592648 X:62905008-62905030 AAATGGAAACAAAAAAAGGCAGG - Intergenic
1191707771 X:64112561-64112583 AATGGAAAACAAAAAGAGGCAGG - Intergenic
1191745470 X:64482192-64482214 AACTGAAAACAAAAAGAGGCAGG - Intergenic
1191919320 X:66237941-66237963 AAATGGAAACACAAAGAAGCAGG - Intronic
1192454810 X:71267781-71267803 AAGTGAAAGCGAAGAGAGGCTGG - Intergenic
1192666328 X:73090957-73090979 AAGTAGTATCCAAAAGAGACTGG - Intergenic
1192685742 X:73303456-73303478 AATGGGAAACAAAAAAAGGCAGG - Intergenic
1192918820 X:75684211-75684233 AATGGAAAACAAAAAGAGGCAGG - Intergenic
1193059213 X:77186769-77186791 AATGGAAAACAAAAAGAGGCAGG + Intergenic
1193363144 X:80599305-80599327 AGGTGGAGTCTACAAGAGGCAGG + Intergenic
1193537244 X:82730123-82730145 AAGTGAAAGTAAAGAGAGGCTGG - Intergenic
1194186081 X:90775748-90775770 AAGTGAAGGCAAAGAGAGGCTGG + Intergenic
1194308372 X:92275490-92275512 AAGTGAAGACAAAGAGAGGCTGG + Intronic
1194351457 X:92827779-92827801 AAGTGAAGACAAAGAGAGGCTGG - Intergenic
1194367275 X:93026216-93026238 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
1194502808 X:94701246-94701268 AAGTGAAAGCGAAGAGAGGCTGG + Intergenic
1194660856 X:96627315-96627337 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
1194834388 X:98663203-98663225 AAATGGAATCAATGTGAGGCAGG + Intergenic
1194982204 X:100452326-100452348 AACAGGAAACAAAAAAAGGCAGG + Intergenic
1195092364 X:101473125-101473147 AATGGAAAACAAAAAGAGGCAGG + Intronic
1195099699 X:101542517-101542539 AATGGGAAACAAAAAAAGGCAGG + Intergenic
1195103836 X:101583858-101583880 AATGGGAAACAAAAAAAGGCAGG - Intergenic
1195113960 X:101677094-101677116 AAGGGAAATCAGAAAGAGGGTGG - Intergenic
1195147698 X:102033744-102033766 AATGGAAAACAAAAAGAGGCAGG + Intergenic
1195216720 X:102711345-102711367 AAGAGGATTCAAAAGGAGCCAGG + Intergenic
1195832646 X:109076619-109076641 AAATGGAAACAAAAAAAAGCAGG - Intergenic
1196165717 X:112533901-112533923 AAGTGAAAGCGAAGAGAGGCTGG - Intergenic
1196220815 X:113111142-113111164 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
1196227041 X:113179220-113179242 AAGTGAAAGCGAAGAGAGGCTGG + Intergenic
1196252796 X:113481573-113481595 AATGGGAAACAAAAAAAGGCAGG + Intergenic
1196300176 X:114043269-114043291 AAGTGAAAGCGAAGAGAGGCTGG - Intergenic
1196330996 X:114470048-114470070 AAGTGAAAGCGAAGAGAGGCTGG - Intergenic
1196525302 X:116723381-116723403 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
1196572669 X:117282439-117282461 AAGTTAAAGCAAAGAGAGGCTGG - Intergenic
1196773696 X:119320203-119320225 AAGTGAAGGCAAAGAGAGGCTGG + Intergenic
1196857990 X:120001257-120001279 ATGTCAAATAAAAAAGAGGCAGG + Intergenic
1196992502 X:121345419-121345441 AAGTGAAAGCGAAGAGAGGCTGG + Intergenic
1197284474 X:124580084-124580106 ATGTGGATCAAAAAAGAGGCAGG + Intronic
1197382710 X:125765371-125765393 AAGTGGAAGAAAAAAGGGGAAGG - Intergenic
1197499889 X:127229877-127229899 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
1197933261 X:131715357-131715379 AAGTGAAGGCAAAGAGAGGCTGG - Intergenic
1198598616 X:138262090-138262112 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
1198599227 X:138266742-138266764 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
1198623296 X:138538163-138538185 AAGTGGTATCAGAAAGGGGAGGG - Intergenic
1198876232 X:141230280-141230302 GAATGGAACCAAAAAGAAGCAGG + Intergenic
1198917088 X:141685192-141685214 GAATGGAACCAAAAAGAAGCAGG + Intronic
1198983582 X:142425994-142426016 AAGTGAAAGCGAAGAGAGGCTGG + Intergenic
1199171882 X:144742575-144742597 AAGTGAAAGCAAAAAGATACTGG - Intergenic
1199484034 X:148329286-148329308 AAGTGGAAAACAAAAAAGGCAGG - Intergenic
1199576650 X:149318946-149318968 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
1200343501 X:155424283-155424305 AATGGGAAACAAAAAAAGGCAGG + Intergenic
1200400720 X:156018976-156018998 AAGTGGAGTCTGACAGAGGCAGG - Intergenic
1200532675 Y:4357828-4357850 AAGTGAAGGCAAAGAGAGGCTGG + Intergenic
1200659779 Y:5944471-5944493 AAGTGAAGACAAAGAGAGGCTGG - Intergenic
1200675485 Y:6142475-6142497 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
1200813012 Y:7504023-7504045 AAGTGAAAACAAAGAGAGGCTGG - Intergenic
1200903455 Y:8457224-8457246 AAATGGAAACAAAAAAGGGCAGG - Intergenic
1201120715 Y:10870699-10870721 AAGTGGAATGAAATGGAGTCGGG - Intergenic
1201307348 Y:12562378-12562400 AAGTGAAAGCGAAGAGAGGCTGG + Intergenic
1201581553 Y:15515665-15515687 AAGTGAAAGCGAAGAGAGGCTGG - Intergenic
1202265687 Y:23015488-23015510 GAATTGAATCAAAAATAGGCAGG - Intergenic
1202418680 Y:24649230-24649252 GAATTGAATCAAAAATAGGCAGG - Intergenic
1202452106 Y:25020856-25020878 GAATTGAATCAAAAATAGGCAGG + Intergenic