ID: 1110308947

View in Genome Browser
Species Human (GRCh38)
Location 13:74023879-74023901
Sequence CTGGTGATCTTGAAGAAAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 364
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 337}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110308942_1110308947 26 Left 1110308942 13:74023830-74023852 CCAGAGCATCAGCTGTTCATTGT 0: 1
1: 0
2: 1
3: 8
4: 134
Right 1110308947 13:74023879-74023901 CTGGTGATCTTGAAGAAAAGGGG 0: 1
1: 0
2: 1
3: 25
4: 337

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110308947 Original CRISPR CTGGTGATCTTGAAGAAAAG GGG Intronic
901363786 1:8727798-8727820 CTGCTGACCTTTAAGAATAGTGG - Intronic
901370272 1:8791373-8791395 CTGGAGGTCATGATGAAAAGTGG - Intronic
902842144 1:19081566-19081588 CTCGGGTTCTAGAAGAAAAGCGG + Exonic
906447180 1:45912127-45912149 CTGGGGATTCTGAAAAAAAGAGG + Intronic
908682838 1:66681968-66681990 CTGTTAATGCTGAAGAAAAGTGG + Exonic
908931452 1:69320892-69320914 GTGGTGTGCTTGAAGAAAAAGGG + Intergenic
909201673 1:72697138-72697160 CTTTTGATTTTGAAAAAAAGAGG - Intergenic
910083997 1:83376416-83376438 GAAGTGAGCTTGAAGAAAAGAGG + Intergenic
910905926 1:92178358-92178380 CAGGCAATTTTGAAGAAAAGAGG + Exonic
911037700 1:93567844-93567866 CTTGTGATCTGGAAGAAAGGTGG + Exonic
911790343 1:102007012-102007034 CTGGTGAGGTTGTAGAAAAAAGG + Intergenic
913458431 1:119057927-119057949 ATGGTGTTTTTGAAGAACAGAGG + Intronic
913563479 1:120047125-120047147 CTGCTGTGCTTGAAGGAAAGAGG - Intronic
913634644 1:120746452-120746474 CTGCTGTGCTTGAAGGAAAGAGG + Intergenic
913692368 1:121291249-121291271 CTGGTGACCTAGAAGAATTGTGG + Intronic
914145189 1:144988853-144988875 CTGGTGACCTAGAAGAATTGTGG - Intronic
914284073 1:146206489-146206511 CTGCTGTGCTTGAAGGAAAGAGG - Intronic
914349778 1:146831105-146831127 CTGGGCATCTTGAAGCAGAGGGG - Intergenic
914545104 1:148657228-148657250 CTGCTGTGCTTGAAGGAAAGAGG - Intronic
914621462 1:149413460-149413482 CTGCTGTGCTTGAAGGAAAGAGG + Intergenic
915816199 1:158968451-158968473 CTGGTGAGCTTGCAGAGAAAAGG + Intronic
916720365 1:167480605-167480627 CAGGTGATTTTAAAGAAAATAGG + Intronic
917054499 1:170965069-170965091 TTGGTGAAGTTGAAGAATAGAGG + Intronic
917327858 1:173851537-173851559 CTGCTGTTCTTGAGGAAAAAGGG - Intronic
917979412 1:180259847-180259869 CTGGGGAGCTGGAAGAACAGCGG + Intronic
918497138 1:185153520-185153542 CTGGTGACCTTTAAGAAAACAGG + Intronic
919495969 1:198268411-198268433 CTGGTGAGATTGAAAAGAAGAGG - Intronic
920479688 1:206309606-206309628 CTGGTGACCTAGAAGAATTGTGG + Intronic
920521268 1:206628831-206628853 CTGGGAATCTTGAAGGAAAGAGG + Intergenic
920643303 1:207775663-207775685 CTGGTGATACTCAAGAAAACAGG - Intronic
921594599 1:217040414-217040436 CAGGTGATGTAGAAAAAAAGGGG - Intronic
922160280 1:223074610-223074632 CTGGGGATCCAGAGGAAAAGGGG + Intergenic
923260240 1:232261385-232261407 CTGGTGCTTTTGAGGAAAACTGG - Intergenic
923743327 1:236676424-236676446 TTGGTGAACTTTAAGAAAAAAGG + Intergenic
924396678 1:243628606-243628628 AAGTTGATCTGGAAGAAAAGAGG - Intronic
1062922544 10:1291188-1291210 CTGGTGATTTTGCAGAAGAGGGG - Intronic
1063597146 10:7445759-7445781 CTGTTGTTCTAGAAGAAAAAAGG - Intergenic
1063882716 10:10547543-10547565 CTGGTGATCTTGGAGGCAACTGG - Intergenic
1064614433 10:17137872-17137894 AGGGTGACCTTGAAGGAAAGTGG + Intergenic
1065660812 10:28002573-28002595 CTGGTGTTCATAAAAAAAAGAGG - Intergenic
1065849663 10:29777223-29777245 CTGGTGATATTGAAGGAAGCCGG + Intergenic
1066253394 10:33655565-33655587 CTGGAGTTCTTGAGGAAAGGAGG - Intergenic
1066288140 10:33988518-33988540 CAGTTGGTCTGGAAGAAAAGAGG - Intergenic
1068227938 10:54130910-54130932 CAGTTGATCATGAACAAAAGTGG + Intronic
1068655782 10:59575247-59575269 CTGGTACTCATGGAGAAAAGAGG + Intergenic
1069202442 10:65637663-65637685 CTGGTGAGGATGAAGAAAAAGGG + Intergenic
1070029581 10:72664050-72664072 TTTGTCATCTTGAAGGAAAGAGG - Intergenic
1070746596 10:78937423-78937445 GTGGGGATACTGAAGAAAAGTGG - Intergenic
1073320171 10:102611279-102611301 CTGGGCAACTTGAAGAACAGTGG + Intronic
1073879178 10:107959912-107959934 GTGGTAAGCTTGAGGAAAAGAGG - Intergenic
1075189249 10:120291280-120291302 CTGGTGACCTTAAAGAAAAATGG + Intergenic
1075836173 10:125454611-125454633 CAGGTGCCCGTGAAGAAAAGAGG - Intergenic
1076608410 10:131704219-131704241 CTGGGGATCTAAAAGAGAAGAGG - Intergenic
1079541571 11:21582231-21582253 CTGGGCATTTTGAAGAAATGTGG + Intergenic
1079721533 11:23820464-23820486 CTGGTGATCCTTCAAAAAAGTGG + Intergenic
1081726127 11:45330675-45330697 GTTGTGAGCATGAAGAAAAGAGG - Intergenic
1081783158 11:45727490-45727512 CTGGTGGCCCTGAAGAAAAGGGG + Intergenic
1081921904 11:46786264-46786286 CTGTGGAGCTGGAAGAAAAGGGG - Intronic
1082249673 11:49964301-49964323 CTGGTGATACTGAGGAAAACAGG + Intergenic
1082808496 11:57464442-57464464 CTGGTGAGCTTGTGGATAAGGGG + Intronic
1083763308 11:64830340-64830362 CTGTTTATCTTGAGGAAATGGGG + Intronic
1085103664 11:73823289-73823311 GTGGTGACCCTGAAGAAATGAGG + Intronic
1085714623 11:78861608-78861630 CTGGTCATCTTTAAGGGAAGTGG - Intronic
1086022101 11:82242576-82242598 CTGGTGAGGTTGAAGAGAAAAGG - Intergenic
1086741813 11:90378873-90378895 GGGGTCATTTTGAAGAAAAGGGG + Intergenic
1087788247 11:102379779-102379801 TTGGTGTTCTCTAAGAAAAGGGG + Intergenic
1088775462 11:113078284-113078306 CTCGTGTCCTTAAAGAAAAGGGG - Intronic
1090718205 11:129449269-129449291 CTGCTGCTCTTGAAGGAAAGAGG + Intronic
1092318241 12:7441830-7441852 ATAGTGACCCTGAAGAAAAGTGG - Intronic
1093837857 12:23858552-23858574 CTGGTGAGGTTGCAGAGAAGAGG + Intronic
1095978520 12:47956516-47956538 CTGGTAATTATGAAGAATAGAGG - Intergenic
1096291855 12:50350520-50350542 CTCAAGAACTTGAAGAAAAGAGG - Exonic
1096334794 12:50745912-50745934 CTCGTGAACTGGAAGAACAGAGG - Exonic
1096765225 12:53882154-53882176 CTGGGGATCTTGTTTAAAAGTGG - Intergenic
1098672190 12:73245913-73245935 CTGATGATCTTGGAGATAAAGGG - Intergenic
1099369586 12:81812734-81812756 GTGGTCATTTTGAAGAAAAGGGG - Intergenic
1099619668 12:84985629-84985651 TTGGTGATGTTGAAGGAAAATGG - Intergenic
1099916120 12:88895852-88895874 ATGGTGATGTTGTAGAAAAGAGG - Intergenic
1100492010 12:95089689-95089711 CTGGTGATCTAGAACAAATCAGG + Exonic
1101391738 12:104307164-104307186 CTGCTTACCTTGAAGAAAAAAGG + Intronic
1101715986 12:107312731-107312753 CTGGTGATTTTTAAGAAGTGAGG - Intergenic
1102596785 12:113999041-113999063 CTGGTCATTTTGAAGAAAATGGG + Intergenic
1103000450 12:117381844-117381866 CTGGTGGGCTTGAAGTAAGGAGG - Intronic
1106932197 13:34678681-34678703 CTGGTGATTTTCCAGAAAAGTGG - Intergenic
1107316156 13:39134331-39134353 CAAAAGATCTTGAAGAAAAGGGG - Intergenic
1107612364 13:42128593-42128615 GAGGGGATCTTGAAGAAAACAGG - Intronic
1107658546 13:42615983-42616005 TTGGTGATTTTGTAGAACAGAGG - Intergenic
1108291580 13:48967231-48967253 CTGGTAGCCTTGAAGAAATGTGG + Intergenic
1108336008 13:49443298-49443320 GTGGTGGTCTTGCAGAAACGGGG - Intronic
1108394341 13:49978467-49978489 GGGGTGGCCTTGAAGAAAAGAGG + Intergenic
1108448907 13:50540242-50540264 CTGGCAACCTTGATGAAAAGTGG + Intronic
1110308947 13:74023879-74023901 CTGGTGATCTTGAAGAAAAGGGG + Intronic
1110723193 13:78788737-78788759 CTGGTCATCCTGAAGACAGGGGG + Intergenic
1111104372 13:83626668-83626690 CTGGTATTCGTAAAGAAAAGAGG + Intergenic
1111645178 13:91023300-91023322 CTGTCGATCTTTAAGAAGAGGGG + Intergenic
1111646687 13:91040371-91040393 CTGCTCATCTTGAAGAGAATGGG - Intergenic
1113744429 13:112733257-112733279 CTGCTCATCTTTAAGTAAAGTGG - Intronic
1114127944 14:19752528-19752550 CTGGTGAGCCTGTAGAAAAAAGG + Intronic
1115391850 14:32862751-32862773 CTGGTGAGCTTGTAGAGAAAAGG - Intergenic
1116200013 14:41781347-41781369 CTGTCTATTTTGAAGAAAAGAGG - Intronic
1116295113 14:43097759-43097781 ATGGTGATCTTGGAGAAGACAGG - Intergenic
1117639355 14:57781421-57781443 CTGGTGAGGTTGCAGAGAAGGGG + Intronic
1118466322 14:66034453-66034475 CTGGAGATCTTGAAGGATGGAGG + Intergenic
1119876869 14:78067567-78067589 CTGGTGAGGTTGCAGAGAAGAGG - Intergenic
1120195608 14:81479069-81479091 TTGGTAATTTTGAAGAAAATGGG + Intronic
1120734787 14:88040841-88040863 CTGGTGATCTTGATGTAAGTTGG - Intergenic
1121580969 14:95030176-95030198 CTGGTGAGGATGAAGAGAAGTGG + Intergenic
1122384278 14:101333430-101333452 CTGGTGACCCAGAAGAAAAAGGG + Intergenic
1123607516 15:22049335-22049357 CTGGTGAGCCTGTAGAAAAAAGG + Intergenic
1124139324 15:27063640-27063662 TGGGTGATTTAGAAGAAAAGAGG - Intronic
1125551444 15:40547850-40547872 CTGGGGTTCATGGAGAAAAGTGG - Intronic
1125953598 15:43774729-43774751 CTGTAGAACTGGAAGAAAAGAGG - Exonic
1126170211 15:45689288-45689310 CTGCTAATAATGAAGAAAAGAGG - Intronic
1126765682 15:52008812-52008834 CTGGTGTCCTGGAAGAAAAATGG - Intronic
1127401621 15:58592574-58592596 CTGGTTCCCTTGAAGAAAAATGG + Exonic
1130952431 15:88603722-88603744 TTGGTGATATTGACAAAAAGGGG + Intergenic
1131648911 15:94377654-94377676 CTGGTGATATGGTAGAAAGGAGG + Intronic
1131660437 15:94509375-94509397 CTGGTAATGTTGAATAAGAGAGG - Intergenic
1131795118 15:96008302-96008324 GTTGTGGTCTTGAAGAAAACAGG - Intergenic
1202979751 15_KI270727v1_random:341114-341136 CTGGTGAGCCTGTAGAAAAAAGG + Intergenic
1133363014 16:5188793-5188815 CTGGTTATCCTGGAGATAAGTGG + Intergenic
1133450380 16:5899062-5899084 CTTGTGATCTGGAATAAGAGAGG - Intergenic
1137549118 16:49424705-49424727 CTGGGGTTCTGGAAGGAAAGGGG + Intergenic
1137572188 16:49574022-49574044 CAGGTGATCTTTAAGGAAAGTGG + Intronic
1139984258 16:70884426-70884448 CTGGGCATCTTGAAGCAGAGGGG + Intronic
1140111176 16:72006478-72006500 CTGCTGACCTTGAAGAAACTGGG - Intergenic
1141125578 16:81398326-81398348 CTGGTGATATTGAGGAAATGAGG - Intergenic
1142682732 17:1559998-1560020 CTGCTGTTCTTGAAGATAAAAGG - Intronic
1143072722 17:4310878-4310900 CTGGTGATGTTAAAGAAGTGGGG + Intronic
1143278564 17:5732695-5732717 CTGGTGACCCTGAAAAAGAGAGG - Intergenic
1143495982 17:7312840-7312862 CTGGTGGTGGTGATGAAAAGAGG + Intronic
1143763784 17:9124153-9124175 CTGCTGATTTTTAAGAAAAATGG - Intronic
1144355517 17:14442398-14442420 ATGTTGAAATTGAAGAAAAGAGG - Intergenic
1144393433 17:14818571-14818593 CTGGTGAGGTTGCAGAGAAGAGG - Intergenic
1145880736 17:28351000-28351022 TTGGTGATCTTGAAGGGATGAGG - Intronic
1147403060 17:40192425-40192447 CTGTTTTTCTTGAAGGAAAGGGG + Intronic
1147796995 17:43051110-43051132 CTGAAGATCTGGAAGAAGAGAGG + Exonic
1147913840 17:43874973-43874995 CTGGTGAAGTTGCAGACAAGAGG - Intergenic
1148583600 17:48760997-48761019 CTCGTGACCAGGAAGAAAAGGGG + Intergenic
1150807727 17:68332353-68332375 CTGGGCATCTTGAAAAAAACAGG - Intronic
1152987819 18:335535-335557 CTGGTGTACTTAAAGAAGAGGGG + Intronic
1153502845 18:5766866-5766888 TTAGTCATATTGAAGAAAAGGGG + Intergenic
1153903412 18:9638798-9638820 ATGGTTATCTAGAATAAAAGTGG - Intergenic
1155553953 18:26997204-26997226 TTGGTGATCATGCAGAAAGGTGG + Intronic
1156902658 18:42319498-42319520 CTGCTGATCTAGAAGAGAAGAGG + Intergenic
1157250484 18:46091775-46091797 CTGTTGATCTTGAAGAAACTGGG - Exonic
1157663887 18:49469241-49469263 CTGGTGGTCTTTAACAGAAGAGG - Intergenic
1158939749 18:62396390-62396412 GTAGTGTTCTTGAAGAACAGTGG - Intergenic
1164109822 19:22145615-22145637 CTTGTGATCTTATAGAGAAGTGG + Intergenic
1165053797 19:33160790-33160812 GTGGGGATCTTGAAGAAGAAGGG + Intronic
1165305091 19:34998876-34998898 CTGGTGAGTTAGAAGAACAGCGG + Intronic
1166757983 19:45205960-45205982 GTGGTTATCGTGGAGAAAAGAGG + Intronic
926159822 2:10479599-10479621 TTGGTCATCTTGAAGCAAAATGG - Intergenic
926377444 2:12247651-12247673 ATGTTAATCTTGAACAAAAGAGG - Intergenic
928897837 2:36284995-36285017 CTGGTGACCAGGAAGAAAATAGG + Intergenic
929930259 2:46250013-46250035 CAAGTGATGTTGAAGAACAGGGG - Intergenic
929982580 2:46695801-46695823 TTTGTGACCTTGAAGAAAATGGG + Intergenic
931936636 2:67205339-67205361 CTGATGATTTTGATGCAAAGAGG + Intergenic
932256593 2:70293319-70293341 CTGGAGATCTTCAAGGAACGAGG + Intronic
935359966 2:102238656-102238678 CTGGTTTCCTTGAAGAACAGAGG + Intronic
937531876 2:122838514-122838536 CAGGTGGTCTTGAGGCAAAGTGG - Intergenic
938580095 2:132637965-132637987 GTGGTGATCTTGAATAAAGATGG + Intronic
939058290 2:137389153-137389175 CTGGTGATGGTGCAGAGAAGAGG - Intronic
939976483 2:148722531-148722553 CTGGTGAGGTTGCAGAGAAGAGG + Intronic
940609778 2:155975398-155975420 CTGTTGTTTTAGAAGAAAAGAGG + Intergenic
941590301 2:167411573-167411595 CTGGTGAGGTTGTAGAAAAGGGG + Intergenic
942482521 2:176404465-176404487 CTGGGTAATTTGAAGAAAAGAGG + Intergenic
943359800 2:186904100-186904122 CTGTTGCTATTTAAGAAAAGAGG + Intergenic
943553339 2:189368874-189368896 CAGGTGATCATAAAGAAAAAAGG + Intergenic
944435142 2:199680991-199681013 CTGGAGAAGTGGAAGAAAAGTGG + Intergenic
944654474 2:201864191-201864213 CTGGGGATCTTTAAGAAACTAGG + Intronic
945440534 2:209873708-209873730 CAAGTAATCTTTAAGAAAAGAGG - Intronic
945682454 2:212930412-212930434 CTGGCCAGCTTAAAGAAAAGTGG - Intergenic
1168926243 20:1581924-1581946 CTTGTGCTCTTGGAGAAAGGTGG - Intronic
1169612878 20:7402811-7402833 CTGGCAATATTGAAGAAAAATGG - Intergenic
1169807098 20:9570852-9570874 CAGGTGATAAGGAAGAAAAGTGG - Intronic
1170024998 20:11879464-11879486 CTGATGATCCTGATGAAAGGTGG - Intergenic
1170271702 20:14534352-14534374 GTGGTGAACTTTAAGAAAGGAGG + Intronic
1170787556 20:19480702-19480724 GTGCTGATCTTGCAGAAAGGGGG + Intronic
1171281628 20:23904432-23904454 CTGGTGATGTTGCAGAGAAAAGG - Intergenic
1171992225 20:31705514-31705536 CTGGGGCTCTTTATGAAAAGGGG - Intronic
1172277363 20:33686810-33686832 CTGATGATCCTGAAAAGAAGAGG - Intergenic
1172556319 20:35844524-35844546 GTGGTGATGGTGAAGAAAAATGG - Intronic
1174779390 20:53374620-53374642 CTGGTGAGCTTGCAGAGAAAAGG - Intronic
1174880143 20:54270395-54270417 GTGGAGATTTTAAAGAAAAGAGG + Intergenic
1175672993 20:60921869-60921891 CTGGTGATCAGGTAGAAGAGTGG + Intergenic
1177616897 21:23534443-23534465 GGAGTGATATTGAAGAAAAGCGG - Intergenic
1177868712 21:26544627-26544649 CTGGTGACCCTGAAGAAACACGG + Intronic
1177880597 21:26689786-26689808 ATGGTGCTCTTGAATAAATGAGG - Intergenic
1180302833 22:11051286-11051308 ACTGTGATTTTGAAGAAAAGAGG + Intergenic
1181679964 22:24487918-24487940 CTGGTTATCTAGAACACAAGTGG - Intergenic
1182000843 22:26918483-26918505 ATGGTGGCCTTGGAGAAAAGAGG - Intergenic
1184972491 22:48036212-48036234 CTGGTGAGCTGGGAGGAAAGCGG + Intergenic
949386699 3:3510764-3510786 CTGGGGACCTTGAAGAAACGCGG + Intergenic
949843301 3:8343546-8343568 CTGGTGTTCTGGAAGAAAAATGG + Intergenic
952902910 3:38121518-38121540 CTGATGCTCCTGAAGAAAACGGG - Intronic
954448020 3:50557091-50557113 TGGGGGATCCTGAAGAAAAGGGG - Intergenic
954515214 3:51169093-51169115 CTGGTGAAGTTGCAGAGAAGAGG + Intronic
954527719 3:51287643-51287665 CTGGTGAGGTTGCAGAGAAGAGG + Intronic
954617372 3:51976162-51976184 TTAGTGGTCTGGAAGAAAAGAGG + Intronic
954843348 3:53532590-53532612 CTCTTGATTTTTAAGAAAAGTGG + Intronic
957380400 3:79420741-79420763 CTGGTGAGCTTGCAGAGAAAAGG + Intronic
958598395 3:96260467-96260489 CTTGTGGTATTGCAGAAAAGGGG + Intergenic
958715039 3:97770167-97770189 CTGGTGAAGATGTAGAAAAGGGG - Intronic
960023650 3:112984401-112984423 CTGGAGATTTTTGAGAAAAGTGG - Intergenic
960072947 3:113452323-113452345 CTGGGGATCTTGCTGAAATGTGG - Intronic
960381785 3:116971471-116971493 CTGGAGATATCAAAGAAAAGTGG + Intronic
964000421 3:151764639-151764661 CTGGTGAGGTTGCAGAAAAAAGG + Intergenic
964051450 3:152398989-152399011 CTGGTAATTTTAAAGACAAGGGG - Intronic
964530151 3:157658713-157658735 CTGGTGGCCTAGCAGAAAAGGGG + Intronic
964662729 3:159138470-159138492 ATTGTGATCTAGAAGAACAGAGG - Intronic
965935204 3:174100808-174100830 CTGGTGAACTAGAAAAAAAATGG - Intronic
966454883 3:180103189-180103211 GTGGTCATTTGGAAGAAAAGAGG - Intergenic
966541150 3:181091085-181091107 CTGGTGAGGTTGTAGAAAAAAGG - Intergenic
966649483 3:182283360-182283382 CTGTGGATGTTCAAGAAAAGGGG - Intergenic
966951451 3:184822191-184822213 CTGGTCATTTCTAAGAAAAGTGG + Intronic
967764251 3:193260703-193260725 CTGGTGATGTTGCAGAGAAAAGG + Intronic
970660910 4:18284770-18284792 CAGGTGATGATGAAGATAAGAGG + Intergenic
970894075 4:21082026-21082048 CTGATGATTTCGCAGAAAAGAGG + Intronic
971825183 4:31612048-31612070 CAAAAGATCTTGAAGAAAAGGGG + Intergenic
971924304 4:32987036-32987058 CTGATGAGATTGAAGGAAAGAGG - Intergenic
972097194 4:35363357-35363379 TTGGTGTTCTTGAGGAAAAAGGG - Intergenic
973004717 4:44992808-44992830 ATGGTTATCTGGAAGGAAAGTGG + Intergenic
973710071 4:53621161-53621183 CTGGGGATCTTGGTGAAATGTGG - Intronic
973897566 4:55430090-55430112 CTGGGGTTCTTGAATAAAAATGG - Exonic
974112841 4:57545249-57545271 CTGGCCAACTTGAAGAAATGAGG + Intergenic
974515271 4:62899879-62899901 CTGGTGATATTGCAGAGAAAAGG + Intergenic
974532175 4:63123149-63123171 CTGGAGATTTTGAAGATCAGTGG + Intergenic
975321663 4:73015416-73015438 CTGGTGTTCTGGAGGAAGAGTGG - Intergenic
976311801 4:83620542-83620564 CTGGTGTTCTTGTAAAAAAAAGG - Intergenic
976560859 4:86498958-86498980 CAGGTGAGCTTTAAGAAGAGAGG - Intronic
976855456 4:89599707-89599729 CTGGTGCACTAGAAGCAAAGAGG - Intergenic
978043447 4:104098135-104098157 CTGGTGAGGTTGAAGAGAAAGGG + Intergenic
978253956 4:106670870-106670892 TTTGTCATTTTGAAGAAAAGAGG + Intergenic
978852984 4:113360280-113360302 CTGGTGACCTTGGAGAAACGAGG - Intronic
980452577 4:132994123-132994145 AAGGTGACCATGAAGAAAAGGGG + Intergenic
981302157 4:143199616-143199638 CTGGTGAGGTTCAAAAAAAGGGG - Intronic
981512355 4:145571830-145571852 CTGGTGAGGTTGCAGAGAAGAGG + Intergenic
981779357 4:148408615-148408637 CTGTTGATCATCAAGAAATGTGG - Intronic
982524140 4:156456365-156456387 CTGGTGAGGTTGAGGAAAAAAGG + Intergenic
982871870 4:160589881-160589903 CTGGTAATTATAAAGAAAAGGGG + Intergenic
983190181 4:164746724-164746746 CTGGTGACCCTGCTGAAAAGTGG + Intergenic
984056366 4:174934101-174934123 CTGGTGATGTTGCAGAGAAAAGG - Intronic
984208040 4:176810680-176810702 ATGGTGTTCTTTCAGAAAAGAGG - Intergenic
985562785 5:599809-599831 CTGGTGAAGCTGAAGAAAAAAGG - Intergenic
986020129 5:3794179-3794201 CTGAGGATCTTCTAGAAAAGTGG - Intergenic
987520885 5:18981876-18981898 CTGGTGATGTTGAAGAGAAAGGG - Intergenic
987713184 5:21531039-21531061 CTATTTATTTTGAAGAAAAGGGG - Intergenic
987759892 5:22148098-22148120 TAGGTGGTCGTGAAGAAAAGGGG - Intronic
989330487 5:40252429-40252451 CTGGTGAGGTTGCAGAGAAGGGG - Intergenic
989780186 5:45255415-45255437 CTGGGGATCTTGCCCAAAAGCGG + Intergenic
989786214 5:45334053-45334075 TAAGTGATCTTGGAGAAAAGAGG - Intronic
990020324 5:51118657-51118679 CTGGTGAGCCTGAAGAGAAAAGG + Intergenic
990343098 5:54844386-54844408 CTGGAGCTCTAGAAGAAATGAGG - Intergenic
991006151 5:61830144-61830166 CTGGTGATCTGGATAAGAAGAGG + Intergenic
991894622 5:71381529-71381551 TAGGTGGTCGTGAAGAAAAGGGG - Intergenic
992966100 5:82002145-82002167 CTGGTGAGGTTGAAGAGAAAAGG + Intronic
993011749 5:82491099-82491121 ATGGTGACCTTGGAGGAAAGAGG - Intergenic
994103182 5:95916324-95916346 ATGGTGACCTTGAAGGAATGAGG + Intronic
994113262 5:96032580-96032602 TTGGATATCTTGAAGGAAAGGGG - Intergenic
994221524 5:97201286-97201308 CTGGGAATTTTTAAGAAAAGAGG + Intergenic
994241605 5:97428372-97428394 TGGGTCATCTTTAAGAAAAGAGG - Intergenic
994558417 5:101334153-101334175 CTGGTGAAATTGAAGAGAAAAGG + Intergenic
995329615 5:110932853-110932875 GTGGTCATTTTGAGGAAAAGGGG + Intergenic
996819640 5:127612297-127612319 CTGATGTTCCTTAAGAAAAGGGG - Intergenic
997045036 5:130305748-130305770 CTGGTGACATTGCAGAGAAGAGG + Intergenic
997224919 5:132202740-132202762 GAGGTGATTTTGAAGAAATGTGG - Intronic
998164319 5:139834136-139834158 CTGGTAATGTTGAAGGAATGAGG - Intronic
999546050 5:152629719-152629741 CTGGTGAGGTTGTGGAAAAGAGG - Intergenic
1000227489 5:159279672-159279694 CTGTTGACTTGGAAGAAAAGTGG + Intronic
1000427023 5:161103203-161103225 ATGTTGACCATGAAGAAAAGTGG + Intergenic
1001567425 5:172708673-172708695 TTGGTGAGATTGAAGAGAAGTGG - Intergenic
1003530672 6:6934964-6934986 CTGGGGATCTTGACAAAATGCGG - Intergenic
1004624187 6:17359192-17359214 CTGGTAATTTATAAGAAAAGAGG - Intergenic
1004708244 6:18144684-18144706 CTGGTAATTTTGAGGAAAAGAGG + Intronic
1004749371 6:18545369-18545391 CTGGTGAGGTTGCAGAAAAAAGG - Intergenic
1005489647 6:26335684-26335706 TGGGTAATCTTAAAGAAAAGAGG + Intergenic
1006868179 6:37226211-37226233 ATGGTGATCTTGAGATAAAGGGG - Intronic
1007191007 6:40018401-40018423 CTGGGGATCTAGCAGAAACGAGG + Intergenic
1007205630 6:40148228-40148250 CTGGTGAAGTTGCAGAGAAGAGG + Intergenic
1008745836 6:54668746-54668768 CTGGAGATCTGGATGGAAAGAGG + Intergenic
1009040696 6:58172967-58172989 CAGGTGATGCTGAAGAATAGTGG - Intergenic
1009216554 6:60927498-60927520 CAGGTGATGCTGAAGAATAGTGG - Intergenic
1009785023 6:68325675-68325697 CAAGTGATCTTGAAGAATATGGG - Intergenic
1009922506 6:70079658-70079680 TTGGTGATCTTGAAGGAAGCTGG + Intronic
1010291619 6:74144084-74144106 CTGGTGATGTTGCAGAGAAAAGG - Intergenic
1010915278 6:81609284-81609306 GTGGTGGTCTTGAAGAAATGTGG + Intronic
1011239985 6:85261125-85261147 CTGGCGCTTTTGATGAAAAGTGG + Intergenic
1011362501 6:86542886-86542908 TTGGTGATTTTGCAGAAAAAAGG + Intergenic
1011823861 6:91283586-91283608 CTGTTGAGTTTGAAGGAAAGAGG + Intergenic
1012141098 6:95627907-95627929 CTGGTGAGGTTGAAGAGAAAAGG + Intergenic
1012367919 6:98464847-98464869 CTGGTGATCCTGAATAATACTGG - Intergenic
1014148777 6:118029228-118029250 TTGGTGATCTTGAAGAACAGTGG + Intronic
1014210213 6:118700664-118700686 CTGGTGATCTTGAGAGACAGTGG + Intronic
1014906982 6:127042360-127042382 CTGGTGAGGTTGCAGAAAAAAGG + Intergenic
1016809996 6:148251502-148251524 CTGGTCAACCTGAAGAAAATTGG + Intergenic
1017456212 6:154603802-154603824 CAGCTGATCAAGAAGAAAAGTGG + Intergenic
1018251016 6:161870330-161870352 CTGTGGGTCATGAAGAAAAGGGG + Intronic
1019007598 6:168814034-168814056 CTGGAGATCTTGAAACCAAGTGG - Intergenic
1021605592 7:22406215-22406237 CTGGTGTTTTTTAAGAAGAGGGG + Intergenic
1022669771 7:32445071-32445093 CTGGTGAGGTTGAAGAGAAAAGG + Intergenic
1023651665 7:42376583-42376605 AAGGTAATCTTGAAGAAAACAGG + Intergenic
1024458499 7:49635660-49635682 GTTGAGGTCTTGAAGAAAAGTGG - Intergenic
1027300827 7:76832549-76832571 GAAGTGAGCTTGAAGAAAAGAGG + Intergenic
1027736763 7:81942222-81942244 CTGGTTATATTGAAAAAAAAAGG - Intergenic
1028701362 7:93784537-93784559 CTTGTGAGTTTGTAGAAAAGAGG + Intronic
1029855636 7:103514307-103514329 CTGGTCATCTTTATAAAAAGTGG - Intronic
1030618288 7:111761519-111761541 CTGGAGATCTTCAAGTTAAGGGG + Intronic
1031052643 7:116960135-116960157 GTGGTGATCTAGAAAAAGAGAGG - Intronic
1031651230 7:124292498-124292520 CTGGGGATTTTGAGAAAAAGTGG + Intergenic
1031980843 7:128123340-128123362 CTGGTGCTCTTTTAGAAGAGGGG - Intergenic
1032637706 7:133728079-133728101 CTGCTGATCAACAAGAAAAGTGG - Intronic
1033315913 7:140297399-140297421 CTTGTGGTCTTAAAGGAAAGGGG - Intronic
1034115811 7:148582844-148582866 CTGCTGACCTTGAACACAAGAGG - Intergenic
1034419734 7:150983356-150983378 CTGGTGATGTTGAGGATACGTGG + Intergenic
1034743137 7:153496882-153496904 CTGGTGACCTTGGAGAGCAGAGG + Intergenic
1037380372 8:18278582-18278604 CTGGAGATCTTGAAGAAGGAGGG - Intergenic
1037428840 8:18788109-18788131 CTGGTTTTCTTTAAGACAAGGGG - Intronic
1037746447 8:21649335-21649357 CTGGTAATTTATAAGAAAAGAGG + Intergenic
1038713226 8:29968283-29968305 CTGGTGATGTCAGAGAAAAGAGG - Intergenic
1038841074 8:31185460-31185482 ATGGTGCTCTTGAACCAAAGAGG - Intergenic
1038999009 8:32958847-32958869 CTGGTGATGTTGCAGAGAAAAGG - Intergenic
1042682200 8:71398569-71398591 CTGGTGATACTGAGGCAAAGAGG - Intergenic
1043075299 8:75691236-75691258 CTGGTGATGTTGCAGAGAAAAGG - Intergenic
1043704582 8:83332097-83332119 CTGGTCATCTTCAAGGAAAGTGG + Intergenic
1043737920 8:83770051-83770073 CTGGTGAGGTTGAAGAGAAAAGG + Intergenic
1043963122 8:86440705-86440727 CTGATGTTCCTGAAGAAAAATGG - Intronic
1043984493 8:86677773-86677795 CTGGTCATCTTTAAGAACATTGG + Intronic
1044384219 8:91567966-91567988 CTTGAGACCTAGAAGAAAAGTGG - Intergenic
1045448890 8:102299404-102299426 CTAGTCATCTGGAAGAAAAAAGG - Intronic
1046300978 8:112288696-112288718 ATGGTGTTTTTGAAAAAAAGTGG + Intronic
1047165115 8:122430037-122430059 CTGGTGAAATTGAAGAGAAAAGG + Intergenic
1050202309 9:3158435-3158457 TTGGTTATCTTGAGGAAAAGTGG - Intergenic
1051522089 9:18000700-18000722 TTGGTTATCTTGAACAAAAAAGG + Intergenic
1051896727 9:21995546-21995568 TCGGTGATGTGGAAGAAAAGGGG - Intronic
1052206218 9:25844268-25844290 CTCATTATCTTGAAGAAAAAGGG + Intergenic
1053314380 9:37038937-37038959 ACGGTGAACTAGAAGAAAAGGGG - Intergenic
1056429990 9:86517661-86517683 CTGGTGCTCTTGTAAAAAATTGG + Intergenic
1057304933 9:93906576-93906598 ATGGTGTTATTTAAGAAAAGGGG + Intergenic
1058431118 9:104920378-104920400 TTGGTGATCTAGAATAAGAGTGG + Intronic
1058728763 9:107829213-107829235 CTGGTGAGGATGCAGAAAAGGGG - Intergenic
1060186279 9:121566083-121566105 CTGGTGACCTTGTAAAAGAGGGG - Intergenic
1062709253 9:137964751-137964773 GTGGTCATTTGGAAGAAAAGGGG + Intronic
1185814282 X:3140093-3140115 CAGCTGGTCATGAAGAAAAGAGG + Intergenic
1186391508 X:9164496-9164518 CTGGTAATTTATAAGAAAAGAGG + Intronic
1188982676 X:36741126-36741148 CTGGTGAGGTTGCAGAAAAAAGG - Intergenic
1189887388 X:45562167-45562189 CTGGTGAACTGGAAGTAAAATGG + Intergenic
1190378016 X:49809080-49809102 CTGGTGAGGTTGCAGAAAAAAGG - Intergenic
1190473092 X:50802012-50802034 CGGGTGATGTTGCACAAAAGTGG + Intronic
1191842983 X:65526217-65526239 TGGGTAATTTTGAAGAAAAGAGG - Intronic
1191950081 X:66581052-66581074 GTTGTGATCTGGAGGAAAAGAGG - Intergenic
1192286576 X:69744668-69744690 CAGGTGGTCTTCAAGAAAGGAGG + Intronic
1192302025 X:69915248-69915270 CTAGTGATCTGGAAGAACATGGG - Intronic
1193259194 X:79385576-79385598 CTGGTGAGATTGTAGAAAAAAGG + Intergenic
1193415230 X:81214230-81214252 TTAGTGACCTTGGAGAAAAGCGG + Intronic
1193459197 X:81770141-81770163 CTGGTGAGGTTGTAGAAAAGGGG - Intergenic
1195037420 X:100982518-100982540 CAGGTGATCATGGAGAACAGTGG + Intronic
1195438223 X:104870311-104870333 CTCTTGCTTTTGAAGAAAAGTGG + Intronic
1195777701 X:108425957-108425979 CTGTTGATAATGAAGAAAAATGG - Intronic
1196372144 X:114991188-114991210 CTGCTGATTTTGAAGAAACTTGG - Intergenic
1197422258 X:126252660-126252682 CTGGTGATGTTGCAGAGAAAAGG - Intergenic
1198040452 X:132846433-132846455 CTGATGATCTTGACCAACAGCGG + Intronic
1198806187 X:140497654-140497676 CTGTTGACCTTTCAGAAAAGAGG - Intergenic
1199678354 X:150206653-150206675 TTGGTGTTCTTCAAGAAGAGGGG - Intergenic