ID: 1110310057

View in Genome Browser
Species Human (GRCh38)
Location 13:74038460-74038482
Sequence CGACAAAAAGCAGTGCAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 270
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 252}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110310057 Original CRISPR CGACAAAAAGCAGTGCAGGA GGG Intronic
900986437 1:6075690-6075712 ACAAAAAAAGCAGTCCAGGACGG - Intronic
901134714 1:6985492-6985514 TGACAAAAAGCACTGAAGTAGGG - Intronic
901669521 1:10847597-10847619 GGACAATAAGCAGCACAGGATGG - Intergenic
903955254 1:27021161-27021183 GGACAAAAACCAGAGAAGGAGGG - Intergenic
905341580 1:37282041-37282063 TGAAAAAAAGTAGGGCAGGAAGG - Intergenic
906253639 1:44330949-44330971 AGAGGAAAAGCAGGGCAGGATGG + Intronic
906318390 1:44802456-44802478 TGACAGACAGGAGTGCAGGAAGG + Intronic
906917415 1:50025849-50025871 CCTCAGGAAGCAGTGCAGGAGGG + Intergenic
907506075 1:54919145-54919167 CGGCAAACAGCAGTGGTGGACGG + Intergenic
907602277 1:55783545-55783567 CGGCAAACAGCAGTGGTGGATGG + Intergenic
914245119 1:145879831-145879853 CAACAAAAAGCAGAGCAGCAGGG - Intronic
915296110 1:154923064-154923086 AGAAAAAAAGAAGGGCAGGAAGG - Intergenic
915900678 1:159844565-159844587 GGGAAAAAAGCAGTGTAGGAGGG + Intronic
917918606 1:179729917-179729939 ACCCAGAAAGCAGTGCAGGAAGG - Intergenic
918098752 1:181355433-181355455 CAAAAAATAGCAGTGCATGATGG + Intergenic
919157460 1:193785331-193785353 CTTCAATATGCAGTGCAGGAAGG + Intergenic
920369997 1:205472912-205472934 CCAGAGAAAGCAGGGCAGGAAGG + Intergenic
920493023 1:206433164-206433186 CTGCAAAAAGAAATGCAGGAAGG + Intronic
920639855 1:207741518-207741540 CGGCAAACAGCAGTGGTGGACGG + Intergenic
921430290 1:215057693-215057715 AGAGAAAGGGCAGTGCAGGAAGG + Intronic
922876304 1:228942512-228942534 CGGCAAACAGCAGTGGTGGACGG - Intergenic
922877767 1:228953890-228953912 CGGCAAACAGCAGTGGTGGATGG - Intergenic
924188975 1:241528834-241528856 AGACAAAAAGGAATGAAGGAAGG + Intergenic
1064003060 10:11679434-11679456 CGACAAACCGCAGTGCATGTTGG + Intergenic
1065548377 10:26845353-26845375 AGACACAAAGCAGGGCATGATGG + Intronic
1065677226 10:28189716-28189738 CAACTAAAAGCAGAGAAGGAAGG + Intronic
1066008687 10:31171988-31172010 AGACAAAAAGCAGACCAGGCAGG - Intergenic
1066460793 10:35610568-35610590 TGACACTAAGCAGTGCAGAAAGG - Intergenic
1067813327 10:49448806-49448828 CCCCAAAAAGCAATGAAGGACGG - Intergenic
1068791298 10:61034052-61034074 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1068792074 10:61039517-61039539 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1071326730 10:84525734-84525756 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1071331542 10:84565570-84565592 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1071920215 10:90341484-90341506 AGACAAAAAGCAATGCAAGAAGG + Intergenic
1076424293 10:130356594-130356616 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1078524325 11:12089133-12089155 GGACAGAAAGCAGTGCTGCAAGG - Intergenic
1083319920 11:61839202-61839224 CGACACAAACTAGCGCAGGAGGG - Intronic
1084878722 11:72154300-72154322 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1085452125 11:76640690-76640712 CAAGATAAAGCAGTGCAGCAAGG - Intergenic
1085601994 11:77863342-77863364 CGGCAAAGAGCAGTGGTGGACGG + Intronic
1086582449 11:88414755-88414777 GGAGAAAAAGCAGTGCATGTGGG + Intergenic
1087305480 11:96484646-96484668 AGTCAAAAAGCAGAGGAGGAGGG - Intronic
1088311251 11:108462972-108462994 CAACAAAAAGCTGGGCAGGTTGG + Intronic
1088879797 11:113964486-113964508 CGGCAAACAGCAGTGGGGGATGG - Intergenic
1089526564 11:119101048-119101070 CTTCACAAAGCAGTTCAGGAAGG + Exonic
1089532320 11:119138368-119138390 CTACAAAAAGCAGGGCATGGTGG + Intergenic
1090231241 11:125106052-125106074 AGACAAAAACCAGGGAAGGAGGG + Intronic
1091257800 11:134205985-134206007 CGCCAAAAATCAGTGAAGGAGGG + Intronic
1094688657 12:32746880-32746902 CTACAAAAAGGAGAGCAGGAAGG + Exonic
1095315556 12:40756553-40756575 CAACAAGAAGCAGTACTGGATGG + Intronic
1096351238 12:50902861-50902883 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1097237302 12:57549312-57549334 AGTCAGAAAGCAGTGAAGGAGGG - Intergenic
1102514666 12:113438214-113438236 CCAAAAGAAGCAGTCCAGGAGGG - Exonic
1102535175 12:113575849-113575871 CATCAAACAGCAGTGCAAGAAGG - Intergenic
1102993076 12:117328541-117328563 CAAAAAAAAGCAGGGAAGGATGG - Intronic
1103926642 12:124427102-124427124 CGCCATAAAGCACTGCAGGAAGG + Intronic
1104721015 12:131045270-131045292 CCACATGAAGCAGTGCTGGACGG - Intronic
1105548670 13:21371184-21371206 GGGCAAAAGGCAGTGAAGGAGGG - Intergenic
1106153730 13:27132405-27132427 CAATAAAAAGCAGTACAGGAAGG + Intronic
1107982617 13:45748196-45748218 CGAGAAAAAGCAATGTAGAATGG + Intergenic
1109076049 13:57836431-57836453 CGACAAAAAACAGTAGAGGGAGG + Intergenic
1109680720 13:65748471-65748493 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1110310057 13:74038460-74038482 CGACAAAAAGCAGTGCAGGAGGG + Intronic
1111820395 13:93206892-93206914 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1111947493 13:94681218-94681240 GGGAAAAAAGCAGTGGAGGATGG + Intergenic
1112328391 13:98459195-98459217 GGACAAAATGAAGCGCAGGATGG + Intronic
1114502529 14:23181727-23181749 CCAGAAAAAGGAGTGCAGGACGG - Intronic
1115772955 14:36685717-36685739 TGTCAGAAAGCAGTGCAGGGAGG - Intronic
1116118809 14:40694756-40694778 CGCCAAACAGCAGTGGTGGATGG + Intergenic
1117843175 14:59881780-59881802 GGAGAAAAAGCAGAGCAAGATGG - Intergenic
1117901708 14:60540640-60540662 CAAAAAAAAGCAGTGGAGAAAGG - Intergenic
1119089946 14:71772217-71772239 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1119757056 14:77126558-77126580 GGCCAAAAAGCTGTGTAGGAGGG - Intronic
1120261119 14:82187650-82187672 CAAAAAATAGCTGTGCAGGATGG - Intergenic
1120668514 14:87336230-87336252 CCACAAACAACAGTTCAGGATGG + Intergenic
1126103472 15:45133620-45133642 AGCCAAAAAGCAGTGGAGCAGGG - Intronic
1126477742 15:49083829-49083851 CTAAAAAAGGAAGTGCAGGATGG + Intergenic
1128280678 15:66391566-66391588 CAAAAAAAGGCAGTGCAGGCTGG - Intronic
1129304548 15:74649831-74649853 AGGCACAAAGCATTGCAGGAGGG + Intronic
1129556821 15:76518683-76518705 ACACAAAATGCAGTGCAGCAAGG + Intronic
1129776379 15:78239329-78239351 CGGCAAACAGCAGTGGTGGACGG + Intronic
1131673844 15:94651138-94651160 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1131693371 15:94849820-94849842 CCACAATAAGCAATGCAGGGAGG - Intergenic
1132208347 15:100002139-100002161 AGACAAAAAGCAGCCCAGGATGG - Intronic
1136137176 16:28263556-28263578 TGACAAGAGGCAGGGCAGGAGGG + Intergenic
1136411402 16:30079583-30079605 GCACAAGAAGCAGTGCAGGTGGG + Intronic
1136629070 16:31478828-31478850 GAACCAAAGGCAGTGCAGGAGGG - Intergenic
1137783381 16:51116333-51116355 AGACAACAAGCAGTGGGGGAGGG - Intergenic
1138721446 16:59086725-59086747 AAACAAAAAGAAGTGCAGGATGG - Intergenic
1139554440 16:67698000-67698022 AGACAAAAAGCAGGGCAGAGAGG - Intronic
1143355780 17:6327292-6327314 CTCCAAAAAGGAGTGCAGGCAGG + Intergenic
1143473834 17:7192051-7192073 GGACAGAGAGCAGTGCCGGAGGG + Intronic
1144097831 17:11917803-11917825 TGACAAAAAGATGTGAAGGAAGG - Intronic
1145152856 17:20521080-20521102 CCACAGAAAGCATTGCTGGAGGG - Intergenic
1145327574 17:21843857-21843879 CCACAAAAAGCAGTGGCGGCGGG - Intergenic
1146914611 17:36670623-36670645 TGAGAAAGAGCAGGGCAGGACGG - Intergenic
1149243112 17:54673775-54673797 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1149818991 17:59756031-59756053 CTACAAAATGCAGTACAGGCTGG - Intronic
1150011327 17:61507096-61507118 AGAGAAAAACCTGTGCAGGAGGG + Intergenic
1150269932 17:63857355-63857377 AGAGAAGAAGCACTGCAGGATGG - Intergenic
1151965406 17:77428676-77428698 CTACAGAGAGCAGTGCTGGATGG + Intronic
1153402050 18:4692000-4692022 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1154072752 18:11167794-11167816 GGAGAAAAAGCAGTCCAGGGAGG + Intergenic
1156040445 18:32814937-32814959 CCATTAAAAGCATTGCAGGAGGG + Intergenic
1156908420 18:42381924-42381946 TTACAAATAGCAGTGGAGGAAGG - Intergenic
1157259332 18:46165103-46165125 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1158018220 18:52809650-52809672 CGGCAAACAGCAGTGGGGGACGG + Intronic
1158023023 18:52866152-52866174 CGAAAACAAGCAGTGCGGAAAGG - Intronic
1158152293 18:54386967-54386989 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1158185165 18:54763162-54763184 AGACAAAAAGCAGTAAGGGAGGG + Intronic
1165550977 19:36585420-36585442 CAACTAAAAACAGTGCAGGTGGG - Intronic
1166128173 19:40729074-40729096 GGAGAGAAAGCATTGCAGGAGGG + Intronic
1168147019 19:54425248-54425270 CGGCAAACAGCAGTGGTGGACGG + Intronic
924973622 2:153902-153924 CGACAAACAGCACTGGTGGACGG + Intergenic
924974508 2:160386-160408 CGACAAACAGCCGTGGTGGATGG + Intergenic
926139694 2:10360873-10360895 AGACAGAAAGCAGGGGAGGATGG - Intronic
929542353 2:42832094-42832116 CGGCAAACAGCAGTGGTGGACGG - Intergenic
931038980 2:58275750-58275772 CGGCAAACAGCAGTGGTGGACGG - Intergenic
931155953 2:59630474-59630496 CCACAAAAAGCAATACAGAATGG - Intergenic
932033395 2:68214025-68214047 CAAAAACAAGCAGTGCAGAAAGG + Intronic
932917171 2:75872053-75872075 CGGCAAACAGCAGTGGTGGATGG - Intergenic
932959426 2:76395633-76395655 AGACAAAAAGAAGTACAAGAAGG - Intergenic
935619511 2:105116698-105116720 AGACAAAAACCAGTGCAGAAAGG - Intergenic
936868889 2:117109655-117109677 CGGCAAACAGCAGTGTTGGATGG - Intergenic
937612678 2:123881014-123881036 CAACACACAGCAGTGCAGAAAGG - Intergenic
938621017 2:133053154-133053176 AGACAAAAAGCTGTGAAGAATGG - Intronic
939134088 2:138273520-138273542 CGGCAAACAGCAGTGGTGGACGG + Intergenic
941112867 2:161435827-161435849 CAACAACAAGCAATGCAGAAAGG - Intronic
1169291395 20:4356039-4356061 AGAGAAAAAGTAGAGCAGGAAGG - Intergenic
1170156287 20:13272458-13272480 CCACATAAAACAGTGCTGGAGGG + Intronic
1171500797 20:25591493-25591515 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1172772270 20:37388746-37388768 CAAAAAAAAGAAGTGAAGGAGGG + Intronic
1172947191 20:38698744-38698766 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1174477382 20:50805636-50805658 AGAAAAACAGCAGTGCAGGTGGG - Intronic
1175050354 20:56149968-56149990 TGACAACAGGCAGTGCAGGTTGG - Intergenic
1175101169 20:56579862-56579884 TGCCAAAAAGCAATGCATGAGGG - Intergenic
1177359363 21:20048656-20048678 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1177895730 21:26854808-26854830 CGGCAAACAGCAGTGGTGGAAGG - Intergenic
1177896702 21:26861644-26861666 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1178368454 21:32007285-32007307 CTACAAAAAGCAACGAAGGAAGG - Intronic
1184099797 22:42336084-42336106 CGCCAAAAAACAGAGCAGGTTGG + Intronic
1184943968 22:47787991-47788013 AGAGCAAAAGCAGTGCAGCACGG + Intergenic
950969491 3:17171924-17171946 CTACAGAAAGCAGTGCAGAGTGG + Intronic
952921717 3:38289782-38289804 CGACAAACAGCAGTGGTGGACGG + Intronic
952922699 3:38296929-38296951 CGACAAACAGCAGTGGTGGACGG + Intronic
952936124 3:38399694-38399716 AAACAAAACACAGTGCAGGATGG - Intronic
953714474 3:45306098-45306120 GGGCAGAAAGCAGAGCAGGAGGG - Intergenic
954010511 3:47632759-47632781 CTACAAGAAACAGTTCAGGAAGG + Intronic
954130958 3:48560771-48560793 CAGCAAAGAGCAGAGCAGGAGGG + Intronic
955083561 3:55680010-55680032 CAAATAAAAGCAGTGCTGGATGG - Intronic
955089694 3:55737295-55737317 AGAAGAAAAGCAGTGCAGGCTGG + Intronic
955792117 3:62598790-62598812 AGACATAAAGCAGTGAATGATGG - Intronic
957257308 3:77854857-77854879 AGACACAAAGAAGTTCAGGAAGG - Intergenic
957670503 3:83294814-83294836 ATACAAAAAGTAGTGCAAGATGG - Intergenic
960006990 3:112790777-112790799 CGGCAAACAGCAGTGGTGGATGG + Intronic
960813598 3:121650432-121650454 CTACAATAATCAGTGCAGTATGG + Intronic
963575885 3:147060149-147060171 CGGCAAACAGCAGTGTTGGACGG - Intergenic
965283400 3:166783485-166783507 CCAGAAAAAGCACTGCAGCATGG + Intergenic
967563088 3:190940034-190940056 CAACAAAAAACAGTGCTGAAAGG - Intergenic
969162615 4:5274794-5274816 CGGCAAACAGCAGTGGTGGACGG - Intronic
970433194 4:16007894-16007916 TGACAAAAAGCAGAGCCAGATGG + Intronic
971038116 4:22717771-22717793 GGAAAAAAAGAAGAGCAGGAAGG - Intergenic
972766775 4:42158571-42158593 CGGCAAACAGCAGTGGTGGACGG + Intergenic
975313230 4:72926028-72926050 CGGCAAACAGCAGTGGTGGACGG + Intergenic
975322197 4:73021247-73021269 GGCTAAAAAGCAGTGCTGGAAGG - Intergenic
976515229 4:85956792-85956814 CAGCAAAAAGCAGTGGTGGATGG + Intronic
977251317 4:94692625-94692647 CGGCAAACAGCAGTGGTGGACGG - Intergenic
979606112 4:122640691-122640713 GGAAAAAAAGCAGAGGAGGATGG + Intergenic
980625711 4:135372297-135372319 CGGCAAACAGCAGTGGTGGATGG - Intergenic
980906628 4:138954467-138954489 GGAGAAAAAGCAGTGCGGGATGG - Intergenic
983667444 4:170196968-170196990 CGGCAAACAGCAGTGGTGGATGG + Intergenic
984614008 4:181874921-181874943 GAACAACAGGCAGTGCAGGACGG - Intergenic
985223363 4:187731847-187731869 CTACAAAAATCAGTGGAAGAAGG + Intergenic
985916491 5:2922805-2922827 CTGCAATAAGCAGTGCTGGAGGG - Intergenic
986887348 5:12256134-12256156 TGGAAAAAAGCAGTGGAGGAAGG - Intergenic
987678097 5:21101853-21101875 AGACAAAAAGAAGTGAAGAAAGG - Intergenic
987742564 5:21929007-21929029 TGCCAAAAATCTGTGCAGGAAGG - Intronic
987881994 5:23760030-23760052 GGACCACAAGCAGTCCAGGATGG + Intergenic
988740545 5:34064672-34064694 CGGCAAACAGCAGTGGTGGATGG + Intronic
988957400 5:36332981-36333003 CGGCAAACAGCAGTGGTGGATGG + Intergenic
989848068 5:46171389-46171411 ATACAAAAATTAGTGCAGGATGG + Intergenic
990568466 5:57053839-57053861 CCACAAAAAACAGGGAAGGAGGG + Intergenic
991542920 5:67749333-67749355 CTACAAAGAACAGTGCTGGATGG - Intergenic
992293493 5:75304574-75304596 CGGCAAACAGCAGTGGTGGATGG - Intergenic
992367917 5:76112323-76112345 CACCAAAAGGAAGTGCAGGAGGG + Intronic
992761232 5:79952448-79952470 GGACAGAAAGCAGAGCTGGAGGG - Intergenic
995187265 5:109285033-109285055 CAGCAAAAAGCAGTGCTAGAAGG + Intergenic
996273290 5:121634974-121634996 AAACAATAAGCGGTGCAGGAAGG + Intergenic
1000434396 5:161190220-161190242 AGACAAAAAGAAGTGTATGAGGG - Intergenic
1001679249 5:173544239-173544261 AGACACAGAGCAGGGCAGGAAGG - Intergenic
1003577222 6:7308503-7308525 AGAAAAAAAGCTGTGTAGGATGG + Intronic
1005324148 6:24682705-24682727 CGGCAAACAGCAGTGGTGGATGG + Intronic
1006569242 6:34987035-34987057 AGGCAAAAAGGAGAGCAGGAGGG - Intronic
1006877230 6:37308377-37308399 CAGCAAAAAGCAGTGGAGAAAGG - Intronic
1007739952 6:44004190-44004212 TGACAAAAGGGAGTGCTGGAGGG - Exonic
1008345216 6:50418450-50418472 TGACAGAGAGCAGTGCATGAAGG + Intergenic
1008407483 6:51135539-51135561 TGAGAAAAAACAGTGCAGAAAGG - Intergenic
1008510816 6:52274030-52274052 AGACAAAAAGCAGTGAAAAAGGG + Intronic
1008582777 6:52921518-52921540 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1009702457 6:67201713-67201735 CGGCAAACAGCAGTGTTGGATGG - Intergenic
1011406934 6:87025447-87025469 TGAGAAAGAGCAGTGAAGGAAGG + Intergenic
1012060949 6:94479812-94479834 AGACAAAAAACTGTGCAGAATGG - Intergenic
1013021753 6:106228254-106228276 CGGCAAACAGCAGTGGTGGATGG - Intronic
1014208910 6:118687752-118687774 CGGCAAACAGCAGTGGTGGACGG - Intronic
1015005890 6:128281384-128281406 GGAGAAAAAGGAGTGCGGGAAGG - Intronic
1017569170 6:155724785-155724807 GGACCACAGGCAGTGCAGGACGG + Intergenic
1017651736 6:156589513-156589535 AGACAAAGAGCATTGCAGAAAGG + Intergenic
1017988843 6:159469039-159469061 AGGCAAAAAGGAGTGAAGGAAGG + Intergenic
1020920145 7:14253188-14253210 ATACAAAAATCAGTGCAGCATGG - Intronic
1021885344 7:25131953-25131975 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1022117652 7:27276465-27276487 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1023752373 7:43385022-43385044 GGACAAAACGCAGTTCTGGAAGG + Intronic
1024248808 7:47490929-47490951 CGACACAGAGCACTGAAGGATGG - Intronic
1024470774 7:49767194-49767216 CAGCAGAAAGCAGTGCAGGAAGG - Intergenic
1024479117 7:49845826-49845848 AAACAAACAGCAATGCAGGAAGG + Intronic
1024945108 7:54800297-54800319 CGAGGAAAAGCAGAGCAGGCTGG - Intergenic
1026731471 7:72915365-72915387 AAACAAAAAGCAGTGCATGTTGG - Intronic
1028013983 7:85684105-85684127 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1028587731 7:92468311-92468333 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1028641978 7:93052552-93052574 CCACAAAAATATGTGCAGGAGGG + Intergenic
1028722369 7:94048303-94048325 CTACAAAGAGTAGGGCAGGAGGG + Intergenic
1028993385 7:97074790-97074812 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1029714975 7:102320741-102320763 CGCCCAACAGCAGTGCAGGTGGG + Intronic
1030188910 7:106791214-106791236 AAACAAAATGCAGTGCAGGAGGG - Intergenic
1031250879 7:119378956-119378978 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1031299569 7:120047464-120047486 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1032973495 7:137193715-137193737 CGAAAGAAAGCAGGGAAGGAGGG + Intergenic
1034248764 7:149671695-149671717 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1034249490 7:149676815-149676837 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1034650848 7:152688867-152688889 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1034965015 7:155385412-155385434 CGGCAAACAGCAGTGGTGGACGG + Intronic
1035826047 8:2645133-2645155 TGACAGAGAGCATTGCAGGAGGG + Intergenic
1037123421 8:15317001-15317023 CGGCAAAGAGCAGTGGTGGATGG + Intergenic
1037337942 8:17809877-17809899 AGACAAAATGGGGTGCAGGAGGG - Intergenic
1039604321 8:38868084-38868106 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1040768454 8:50944307-50944329 CGCCCAAAAGCAGTGGTGGACGG + Intergenic
1040774748 8:51028187-51028209 CCAAAAAAAGCAGTGGAGAAAGG - Intergenic
1042120377 8:65481008-65481030 GGTCAAACAGGAGTGCAGGAAGG - Intergenic
1043834178 8:85027747-85027769 CCACAAAGAGCAGATCAGGAGGG + Intergenic
1044081919 8:87896014-87896036 GGACATATAGCTGTGCAGGATGG - Intergenic
1044834153 8:96279498-96279520 TTACAAAAAGTAGTGAAGGAGGG - Intronic
1045788640 8:105955560-105955582 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1045843623 8:106607536-106607558 TGACACAAATCAGTGAAGGAAGG - Intronic
1046279794 8:112011700-112011722 AGAGAAAAATCAGTGGAGGAGGG + Intergenic
1047253254 8:123196657-123196679 TGTCGAAAAACAGTGCAGGAAGG - Intronic
1050254175 9:3776865-3776887 CCACAGAAACCAGAGCAGGATGG + Intergenic
1050307849 9:4323515-4323537 AGACAGAAAGCATTGCAGGCAGG - Intronic
1051333385 9:16045467-16045489 TGACAATAAGCCGTGAAGGAAGG - Intronic
1052412026 9:28134024-28134046 GGAGAAAAAGCAATTCAGGAAGG - Intronic
1056956933 9:91090173-91090195 CTACAAAATGCAGAGCAGGGAGG + Intergenic
1059684421 9:116620896-116620918 CTATAAAAGGCAGTGCAGCAAGG - Intronic
1062186468 9:135221167-135221189 CCCCAAAAGGCAGTGCAGGAAGG + Intergenic
1186586820 X:10884071-10884093 CTACAAAAAGCAGTAGAGTATGG + Intergenic
1188157329 X:26755991-26756013 CGGCAAACAGCAGTGGCGGATGG + Intergenic
1188766336 X:34096501-34096523 ATACAAAAATCAGTTCAGGATGG + Intergenic
1188888294 X:35577885-35577907 TGAAAACAAGCAGTGCAGAAAGG + Intergenic
1191167488 X:57405562-57405584 CGGCAAACAGCAGTGGTGGATGG + Intronic
1192940372 X:75904933-75904955 TGACAAACAGCAGTGGTGGATGG + Intergenic
1193894394 X:87094511-87094533 CAAAAAAAAGCAAGGCAGGAAGG - Intergenic
1195030564 X:100923455-100923477 AGACAAAAAGTAGTGCAGGCTGG - Intronic
1195259091 X:103115404-103115426 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1196287281 X:113897473-113897495 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1197999720 X:132420349-132420371 CGGCAAACAGCAGTGGTGGATGG + Intronic
1198723415 X:139649764-139649786 ATACAAAAAGCAGTTAAGGAAGG + Intronic
1199972215 X:152869740-152869762 CAACAAAAAACAATGCAGGCAGG - Intergenic
1200545735 Y:4516497-4516519 ATACAAAAAGCAGTGAAAGATGG - Intergenic
1201979053 Y:19887602-19887624 CAACCAAAAGAAGTTCAGGATGG - Intergenic
1202251436 Y:22877616-22877638 GGACAAAAAGCTAGGCAGGAGGG + Intergenic
1202404424 Y:24511365-24511387 GGACAAAAAGCTAGGCAGGAGGG + Intergenic
1202466355 Y:25158717-25158739 GGACAAAAAGCTAGGCAGGAGGG - Intergenic